Incidental Mutation 'R8910:Ptprk'
ID 678563
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Name protein tyrosine phosphatase, receptor type, K
Synonyms RPTPkappa, PTPk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8910 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 28074820-28597397 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28492997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 655 (V655A)
Ref Sequence ENSEMBL: ENSMUSP00000151866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
AlphaFold P35822
Predicted Effect probably benign
Transcript: ENSMUST00000166468
AA Change: V655A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: V655A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000218276
AA Change: V655A

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218359
AA Change: V655A

PolyPhen 2 Score 0.582 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,323,649 I1058V probably benign Het
3830406C13Rik A G 14: 12,285,444 H10R probably benign Het
Abca5 T C 11: 110,298,204 E809G probably damaging Het
Akap12 A T 10: 4,313,822 Q77L probably benign Het
Aldh5a1 A G 13: 24,918,616 V288A probably damaging Het
Alox5 C A 6: 116,412,549 E586* probably null Het
Arid5b A G 10: 68,098,278 F598S Het
Btc A C 5: 91,360,812 M157R probably benign Het
Cadps2 T C 6: 23,344,224 N908S probably benign Het
Cd244 C A 1: 171,559,373 H17N probably damaging Het
Cdh15 T C 8: 122,848,501 L5P probably benign Het
Cept1 A C 3: 106,539,249 S94A probably benign Het
Cntn4 T C 6: 106,655,536 M507T probably benign Het
Cpne4 A G 9: 104,922,507 probably benign Het
Dffb T C 4: 153,972,959 D87G possibly damaging Het
Dlgap1 C T 17: 70,786,820 T712I probably damaging Het
Dnhd1 A C 7: 105,683,697 H155P possibly damaging Het
Dpyd A G 3: 118,610,518 K38R probably benign Het
Evx1 C T 6: 52,316,761 R305C probably damaging Het
Ezr A G 17: 6,755,900 L47P probably damaging Het
Fabp6 C T 11: 43,601,508 A2T possibly damaging Het
Fam78a G A 2: 32,069,669 T143M probably damaging Het
Fam83h C T 15: 76,002,995 G831D probably benign Het
Fermt2 G A 14: 45,464,932 A465V probably damaging Het
Fras1 T C 5: 96,567,996 S358P probably benign Het
Frem1 C A 4: 82,950,457 G1429V probably benign Het
Fst T A 13: 114,453,709 probably benign Het
Gfpt1 T C 6: 87,053,805 I57T probably benign Het
Gimap6 A G 6: 48,702,454 I216T probably damaging Het
Gm10267 T A 18: 44,156,444 N73I possibly damaging Het
Gm21188 T A 13: 120,046,820 probably benign Het
H2-M2 G A 17: 37,481,522 T286I probably damaging Het
Hgs T C 11: 120,478,376 probably null Het
Klra6 T C 6: 130,016,684 E208G probably benign Het
L3mbtl1 A T 2: 162,970,293 T753S probably benign Het
Larp6 A G 9: 60,713,243 E13G probably benign Het
Mroh2b A G 15: 4,931,373 I806V probably benign Het
Myo1g T C 11: 6,518,009 N142S possibly damaging Het
Myo3a A G 2: 22,574,268 T1112A probably benign Het
Olfr1272 C A 2: 90,296,504 R119L possibly damaging Het
Pelp1 A T 11: 70,396,635 M449K probably damaging Het
Ppp4r1 T C 17: 65,837,773 V795A probably damaging Het
Ppp4r3b G T 11: 29,196,290 M372I probably null Het
Rad51d T C 11: 82,882,967 R166G probably damaging Het
Rbm19 T A 5: 120,133,779 Y650N probably damaging Het
Rreb1 A G 13: 37,948,765 K204E Het
Ryr1 A G 7: 29,071,915 L2567P probably damaging Het
Scn3a T A 2: 65,508,539 S599C probably damaging Het
Slc7a15 T A 12: 8,539,117 probably benign Het
Taf6 T C 5: 138,184,454 T12A probably benign Het
Tbc1d10b T C 7: 127,207,766 T200A probably benign Het
Tex21 C T 12: 76,216,759 probably benign Het
Thap4 T C 1: 93,714,944 H515R probably damaging Het
Tmem94 A G 11: 115,797,426 Q1237R probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Unc5a A G 13: 55,003,588 E695G possibly damaging Het
Wtip G A 7: 34,132,638 P141L possibly damaging Het
Wwp1 A T 4: 19,627,741 M718K possibly damaging Het
Zbtb25 A C 12: 76,349,134 V438G probably damaging Het
Zfp444 T C 7: 6,184,027 L46P probably damaging Het
Zfp521 T C 18: 13,844,176 H1060R probably benign Het
Zkscan14 A G 5: 145,195,380 F447S probably damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 splice site probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
R7585:Ptprk UTSW 10 28560088 missense probably damaging 1.00
R7661:Ptprk UTSW 10 28466040 missense probably benign 0.00
R7694:Ptprk UTSW 10 28589370 missense possibly damaging 0.63
R7740:Ptprk UTSW 10 28496924 missense probably damaging 1.00
R7810:Ptprk UTSW 10 28592857 missense probably damaging 0.97
R7831:Ptprk UTSW 10 28568408 missense possibly damaging 0.89
R7836:Ptprk UTSW 10 28573389 missense probably damaging 1.00
R8049:Ptprk UTSW 10 28383569 missense possibly damaging 0.84
R8235:Ptprk UTSW 10 28589041 missense possibly damaging 0.70
R8274:Ptprk UTSW 10 28580412 missense probably damaging 1.00
R8286:Ptprk UTSW 10 28568327 missense probably damaging 1.00
R8372:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R8727:Ptprk UTSW 10 28566545 unclassified probably benign
R8794:Ptprk UTSW 10 28263508 nonsense probably null
R8842:Ptprk UTSW 10 28566501 missense probably damaging 0.97
R8861:Ptprk UTSW 10 28570190 missense probably damaging 1.00
R8897:Ptprk UTSW 10 28591957 missense probably damaging 1.00
R8919:Ptprk UTSW 10 28483207 nonsense probably null
R8976:Ptprk UTSW 10 28585673 missense probably damaging 1.00
R8982:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R9036:Ptprk UTSW 10 28585932 missense probably benign 0.01
R9135:Ptprk UTSW 10 28580417 missense probably damaging 1.00
R9308:Ptprk UTSW 10 28574854 missense probably benign 0.15
R9317:Ptprk UTSW 10 28354735 missense probably damaging 0.96
Z1177:Ptprk UTSW 10 28493120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTACATGCACTGGGAAG -3'
(R):5'- TGAGAGTAATCTCACCTTCTCCAC -3'

Sequencing Primer
(F):5'- CACTGGGAAGCCGCCTG -3'
(R):5'- CACTGCTCATCGCTTGGAAATAG -3'
Posted On 2021-08-02