Incidental Mutation 'R8910:Mroh2b'
ID 678582
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Name maestro heat-like repeat family member 2B
Synonyms 4930455B06Rik, Heatr7b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock # R8910 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 4898737-4962205 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4931373 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 806 (I806V)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
AlphaFold Q7M6Y6
Predicted Effect probably benign
Transcript: ENSMUST00000045736
AA Change: I806V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: I806V

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,323,649 I1058V probably benign Het
3830406C13Rik A G 14: 12,285,444 H10R probably benign Het
Abca5 T C 11: 110,298,204 E809G probably damaging Het
Akap12 A T 10: 4,313,822 Q77L probably benign Het
Aldh5a1 A G 13: 24,918,616 V288A probably damaging Het
Alox5 C A 6: 116,412,549 E586* probably null Het
Arid5b A G 10: 68,098,278 F598S Het
Btc A C 5: 91,360,812 M157R probably benign Het
Cadps2 T C 6: 23,344,224 N908S probably benign Het
Cd244 C A 1: 171,559,373 H17N probably damaging Het
Cdh15 T C 8: 122,848,501 L5P probably benign Het
Cept1 A C 3: 106,539,249 S94A probably benign Het
Cntn4 T C 6: 106,655,536 M507T probably benign Het
Cpne4 A G 9: 104,922,507 probably benign Het
Dffb T C 4: 153,972,959 D87G possibly damaging Het
Dlgap1 C T 17: 70,786,820 T712I probably damaging Het
Dnhd1 A C 7: 105,683,697 H155P possibly damaging Het
Dpyd A G 3: 118,610,518 K38R probably benign Het
Evx1 C T 6: 52,316,761 R305C probably damaging Het
Ezr A G 17: 6,755,900 L47P probably damaging Het
Fabp6 C T 11: 43,601,508 A2T possibly damaging Het
Fam78a G A 2: 32,069,669 T143M probably damaging Het
Fam83h C T 15: 76,002,995 G831D probably benign Het
Fermt2 G A 14: 45,464,932 A465V probably damaging Het
Fras1 T C 5: 96,567,996 S358P probably benign Het
Frem1 C A 4: 82,950,457 G1429V probably benign Het
Fst T A 13: 114,453,709 probably benign Het
Gfpt1 T C 6: 87,053,805 I57T probably benign Het
Gimap6 A G 6: 48,702,454 I216T probably damaging Het
Gm10267 T A 18: 44,156,444 N73I possibly damaging Het
Gm21188 T A 13: 120,046,820 probably benign Het
H2-M2 G A 17: 37,481,522 T286I probably damaging Het
Hgs T C 11: 120,478,376 probably null Het
Klra6 T C 6: 130,016,684 E208G probably benign Het
L3mbtl1 A T 2: 162,970,293 T753S probably benign Het
Larp6 A G 9: 60,713,243 E13G probably benign Het
Myo1g T C 11: 6,518,009 N142S possibly damaging Het
Myo3a A G 2: 22,574,268 T1112A probably benign Het
Olfr1272 C A 2: 90,296,504 R119L possibly damaging Het
Pelp1 A T 11: 70,396,635 M449K probably damaging Het
Ppp4r1 T C 17: 65,837,773 V795A probably damaging Het
Ppp4r3b G T 11: 29,196,290 M372I probably null Het
Ptprk T C 10: 28,492,997 V655A possibly damaging Het
Rad51d T C 11: 82,882,967 R166G probably damaging Het
Rbm19 T A 5: 120,133,779 Y650N probably damaging Het
Rreb1 A G 13: 37,948,765 K204E Het
Ryr1 A G 7: 29,071,915 L2567P probably damaging Het
Scn3a T A 2: 65,508,539 S599C probably damaging Het
Slc7a15 T A 12: 8,539,117 probably benign Het
Taf6 T C 5: 138,184,454 T12A probably benign Het
Tbc1d10b T C 7: 127,207,766 T200A probably benign Het
Tex21 C T 12: 76,216,759 probably benign Het
Thap4 T C 1: 93,714,944 H515R probably damaging Het
Tmem94 A G 11: 115,797,426 Q1237R probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Unc5a A G 13: 55,003,588 E695G possibly damaging Het
Wtip G A 7: 34,132,638 P141L possibly damaging Het
Wwp1 A T 4: 19,627,741 M718K possibly damaging Het
Zbtb25 A C 12: 76,349,134 V438G probably damaging Het
Zfp444 T C 7: 6,184,027 L46P probably damaging Het
Zfp521 T C 18: 13,844,176 H1060R probably benign Het
Zkscan14 A G 5: 145,195,380 F447S probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
R8728:Mroh2b UTSW 15 4905640 missense probably damaging 1.00
R8747:Mroh2b UTSW 15 4935300 missense probably damaging 0.99
R8798:Mroh2b UTSW 15 4948709 missense probably damaging 1.00
R8814:Mroh2b UTSW 15 4941625 missense possibly damaging 0.61
R8856:Mroh2b UTSW 15 4931028 nonsense probably null
R8913:Mroh2b UTSW 15 4917528 intron probably benign
R8941:Mroh2b UTSW 15 4962124 missense possibly damaging 0.86
R9014:Mroh2b UTSW 15 4899188 start codon destroyed probably null 0.95
R9086:Mroh2b UTSW 15 4953272 critical splice acceptor site probably null
R9101:Mroh2b UTSW 15 4900453 missense probably benign 0.20
R9118:Mroh2b UTSW 15 4962091 missense possibly damaging 0.86
R9393:Mroh2b UTSW 15 4951184 missense probably benign
R9429:Mroh2b UTSW 15 4934425 missense probably damaging 1.00
R9431:Mroh2b UTSW 15 4934470 missense probably damaging 1.00
R9443:Mroh2b UTSW 15 4944339 missense probably damaging 1.00
R9447:Mroh2b UTSW 15 4931341 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGTGTTCCATGTAAAAGTG -3'
(R):5'- ACTGCAATGGGGAATATGACTC -3'

Sequencing Primer
(F):5'- CAAGTGTTCCATGTAAAAGTGATGAC -3'
(R):5'- CCTGGTCAAAACTGTGAAGTC -3'
Posted On 2021-08-02