Mutagenetix > Incidental Mutations

Incidental Mutation 'R8910:Mroh2b'

678582

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R8910 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4931373 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 806 (I806V)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

probably benign
Transcript: ENSMUST00000045736
AA Change: I806V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: I806V

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	G	13: 77,323,649	I1058V	probably benign	Het
3830406C13Rik	A	G	14: 12,285,444	H10R	probably benign	Het
Abca5	T	C	11: 110,298,204	E809G	probably damaging	Het
Akap12	A	T	10: 4,313,822	Q77L	probably benign	Het
Aldh5a1	A	G	13: 24,918,616	V288A	probably damaging	Het
Alox5	C	A	6: 116,412,549	E586*	probably null	Het
Arid5b	A	G	10: 68,098,278	F598S		Het
Btc	A	C	5: 91,360,812	M157R	probably benign	Het
Cadps2	T	C	6: 23,344,224	N908S	probably benign	Het
Cd244	C	A	1: 171,559,373	H17N	probably damaging	Het
Cdh15	T	C	8: 122,848,501	L5P	probably benign	Het
Cept1	A	C	3: 106,539,249	S94A	probably benign	Het
Cntn4	T	C	6: 106,655,536	M507T	probably benign	Het
Cpne4	A	G	9: 104,922,507		probably benign	Het
Dffb	T	C	4: 153,972,959	D87G	possibly damaging	Het
Dlgap1	C	T	17: 70,786,820	T712I	probably damaging	Het
Dnhd1	A	C	7: 105,683,697	H155P	possibly damaging	Het
Dpyd	A	G	3: 118,610,518	K38R	probably benign	Het
Evx1	C	T	6: 52,316,761	R305C	probably damaging	Het
Ezr	A	G	17: 6,755,900	L47P	probably damaging	Het
Fabp6	C	T	11: 43,601,508	A2T	possibly damaging	Het
Fam78a	G	A	2: 32,069,669	T143M	probably damaging	Het
Fam83h	C	T	15: 76,002,995	G831D	probably benign	Het
Fermt2	G	A	14: 45,464,932	A465V	probably damaging	Het
Fras1	T	C	5: 96,567,996	S358P	probably benign	Het
Frem1	C	A	4: 82,950,457	G1429V	probably benign	Het
Fst	T	A	13: 114,453,709		probably benign	Het
Gfpt1	T	C	6: 87,053,805	I57T	probably benign	Het
Gimap6	A	G	6: 48,702,454	I216T	probably damaging	Het
Gm10267	T	A	18: 44,156,444	N73I	possibly damaging	Het
Gm21188	T	A	13: 120,046,820		probably benign	Het
H2-M2	G	A	17: 37,481,522	T286I	probably damaging	Het
Hgs	T	C	11: 120,478,376		probably null	Het
Klra6	T	C	6: 130,016,684	E208G	probably benign	Het
L3mbtl1	A	T	2: 162,970,293	T753S	probably benign	Het
Larp6	A	G	9: 60,713,243	E13G	probably benign	Het
Myo1g	T	C	11: 6,518,009	N142S	possibly damaging	Het
Myo3a	A	G	2: 22,574,268	T1112A	probably benign	Het
Olfr1272	C	A	2: 90,296,504	R119L	possibly damaging	Het
Pelp1	A	T	11: 70,396,635	M449K	probably damaging	Het
Ppp4r1	T	C	17: 65,837,773	V795A	probably damaging	Het
Ppp4r3b	G	T	11: 29,196,290	M372I	probably null	Het
Ptprk	T	C	10: 28,492,997	V655A	possibly damaging	Het
Rad51d	T	C	11: 82,882,967	R166G	probably damaging	Het
Rbm19	T	A	5: 120,133,779	Y650N	probably damaging	Het
Rreb1	A	G	13: 37,948,765	K204E		Het
Ryr1	A	G	7: 29,071,915	L2567P	probably damaging	Het
Scn3a	T	A	2: 65,508,539	S599C	probably damaging	Het
Slc7a15	T	A	12: 8,539,117		probably benign	Het
Taf6	T	C	5: 138,184,454	T12A	probably benign	Het
Tbc1d10b	T	C	7: 127,207,766	T200A	probably benign	Het
Tex21	C	T	12: 76,216,759		probably benign	Het
Thap4	T	C	1: 93,714,944	H515R	probably damaging	Het
Tmem94	A	G	11: 115,797,426	Q1237R	probably damaging	Het
Tppp3	A	G	8: 105,468,292	V69A	probably benign	Het
Unc5a	A	G	13: 55,003,588	E695G	possibly damaging	Het
Wtip	G	A	7: 34,132,638	P141L	possibly damaging	Het
Wwp1	A	T	4: 19,627,741	M718K	possibly damaging	Het
Zbtb25	A	C	12: 76,349,134	V438G	probably damaging	Het
Zfp444	T	C	7: 6,184,027	L46P	probably damaging	Het
Zfp521	T	C	18: 13,844,176	H1060R	probably benign	Het
Zkscan14	A	G	5: 145,195,380	F447S	probably damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8814:Mroh2b	UTSW	15	4941625	missense	possibly damaging	0.61
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8913:Mroh2b	UTSW	15	4917528	intron	probably benign
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9429:Mroh2b	UTSW	15	4934425	missense	probably damaging	1.00
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
R9443:Mroh2b	UTSW	15	4944339	missense	probably damaging	1.00
R9447:Mroh2b	UTSW	15	4931341	missense	probably damaging	1.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCAAGTGTTCCATGTAAAAGTG -3'
(R):5'- ACTGCAATGGGGAATATGACTC -3'

Sequencing Primer
(F):5'- CAAGTGTTCCATGTAAAAGTGATGAC -3'
(R):5'- CCTGGTCAAAACTGTGAAGTC -3'

Posted On

2021-08-02