Incidental Mutation 'R8910:H2-M2'
ID 678585
Institutional Source Beutler Lab
Gene Symbol H2-M2
Ensembl Gene ENSMUSG00000016283
Gene Name histocompatibility 2, M region locus 2
Synonyms Thy19.4, H-2M2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R8910 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 37480851-37483552 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 37481522 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 286 (T286I)
Ref Sequence ENSEMBL: ENSMUSP00000131297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016427] [ENSMUST00000171139]
AlphaFold Q6W9L1
Predicted Effect probably damaging
Transcript: ENSMUST00000016427
AA Change: T286I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000016427
Gene: ENSMUSG00000016283
AA Change: T286I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 29 207 1.6e-77 PFAM
IGc1 226 297 2.11e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171139
AA Change: T286I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131297
Gene: ENSMUSG00000016283
AA Change: T286I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 29 207 7.1e-76 PFAM
IGc1 226 297 2.11e-20 SMART
transmembrane domain 308 330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,323,649 I1058V probably benign Het
3830406C13Rik A G 14: 12,285,444 H10R probably benign Het
Abca5 T C 11: 110,298,204 E809G probably damaging Het
Akap12 A T 10: 4,313,822 Q77L probably benign Het
Aldh5a1 A G 13: 24,918,616 V288A probably damaging Het
Alox5 C A 6: 116,412,549 E586* probably null Het
Arid5b A G 10: 68,098,278 F598S Het
Btc A C 5: 91,360,812 M157R probably benign Het
Cadps2 T C 6: 23,344,224 N908S probably benign Het
Cd244 C A 1: 171,559,373 H17N probably damaging Het
Cdh15 T C 8: 122,848,501 L5P probably benign Het
Cept1 A C 3: 106,539,249 S94A probably benign Het
Cntn4 T C 6: 106,655,536 M507T probably benign Het
Cpne4 A G 9: 104,922,507 probably benign Het
Dffb T C 4: 153,972,959 D87G possibly damaging Het
Dlgap1 C T 17: 70,786,820 T712I probably damaging Het
Dnhd1 A C 7: 105,683,697 H155P possibly damaging Het
Dpyd A G 3: 118,610,518 K38R probably benign Het
Evx1 C T 6: 52,316,761 R305C probably damaging Het
Ezr A G 17: 6,755,900 L47P probably damaging Het
Fabp6 C T 11: 43,601,508 A2T possibly damaging Het
Fam78a G A 2: 32,069,669 T143M probably damaging Het
Fam83h C T 15: 76,002,995 G831D probably benign Het
Fermt2 G A 14: 45,464,932 A465V probably damaging Het
Fras1 T C 5: 96,567,996 S358P probably benign Het
Frem1 C A 4: 82,950,457 G1429V probably benign Het
Fst T A 13: 114,453,709 probably benign Het
Gfpt1 T C 6: 87,053,805 I57T probably benign Het
Gimap6 A G 6: 48,702,454 I216T probably damaging Het
Gm10267 T A 18: 44,156,444 N73I possibly damaging Het
Gm21188 T A 13: 120,046,820 probably benign Het
Hgs T C 11: 120,478,376 probably null Het
Klra6 T C 6: 130,016,684 E208G probably benign Het
L3mbtl1 A T 2: 162,970,293 T753S probably benign Het
Larp6 A G 9: 60,713,243 E13G probably benign Het
Mroh2b A G 15: 4,931,373 I806V probably benign Het
Myo1g T C 11: 6,518,009 N142S possibly damaging Het
Myo3a A G 2: 22,574,268 T1112A probably benign Het
Olfr1272 C A 2: 90,296,504 R119L possibly damaging Het
Pelp1 A T 11: 70,396,635 M449K probably damaging Het
Ppp4r1 T C 17: 65,837,773 V795A probably damaging Het
Ppp4r3b G T 11: 29,196,290 M372I probably null Het
Ptprk T C 10: 28,492,997 V655A possibly damaging Het
Rad51d T C 11: 82,882,967 R166G probably damaging Het
Rbm19 T A 5: 120,133,779 Y650N probably damaging Het
Rreb1 A G 13: 37,948,765 K204E Het
Ryr1 A G 7: 29,071,915 L2567P probably damaging Het
Scn3a T A 2: 65,508,539 S599C probably damaging Het
Slc7a15 T A 12: 8,539,117 probably benign Het
Taf6 T C 5: 138,184,454 T12A probably benign Het
Tbc1d10b T C 7: 127,207,766 T200A probably benign Het
Tex21 C T 12: 76,216,759 probably benign Het
Thap4 T C 1: 93,714,944 H515R probably damaging Het
Tmem94 A G 11: 115,797,426 Q1237R probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Unc5a A G 13: 55,003,588 E695G possibly damaging Het
Wtip G A 7: 34,132,638 P141L possibly damaging Het
Wwp1 A T 4: 19,627,741 M718K possibly damaging Het
Zbtb25 A C 12: 76,349,134 V438G probably damaging Het
Zfp444 T C 7: 6,184,027 L46P probably damaging Het
Zfp521 T C 18: 13,844,176 H1060R probably benign Het
Zkscan14 A G 5: 145,195,380 F447S probably damaging Het
Other mutations in H2-M2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01683:H2-M2 APN 17 37481515 missense possibly damaging 0.95
Lock UTSW 17 37481508 missense probably damaging 1.00
Nokia UTSW 17 37481306 missense possibly damaging 0.59
R0799:H2-M2 UTSW 17 37482749 missense probably damaging 1.00
R0981:H2-M2 UTSW 17 37482630 missense probably benign 0.02
R1925:H2-M2 UTSW 17 37482500 missense probably damaging 0.98
R2959:H2-M2 UTSW 17 37483454 missense probably benign 0.20
R3968:H2-M2 UTSW 17 37481306 missense possibly damaging 0.59
R4063:H2-M2 UTSW 17 37481508 missense probably damaging 1.00
R4735:H2-M2 UTSW 17 37483244 missense possibly damaging 0.91
R5806:H2-M2 UTSW 17 37481726 missense probably damaging 1.00
R6410:H2-M2 UTSW 17 37483213 missense probably damaging 1.00
R7432:H2-M2 UTSW 17 37481470 critical splice donor site probably null
R7456:H2-M2 UTSW 17 37481661 missense possibly damaging 0.60
R7535:H2-M2 UTSW 17 37482637 missense probably benign 0.07
R7680:H2-M2 UTSW 17 37483025 missense possibly damaging 0.56
R8112:H2-M2 UTSW 17 37483492 missense unknown
R9034:H2-M2 UTSW 17 37481285 missense probably benign 0.05
R9193:H2-M2 UTSW 17 37482537 missense probably benign 0.00
R9420:H2-M2 UTSW 17 37481324 missense not run
Predicted Primers PCR Primer
(F):5'- AGGCCAACAGCAACTATTATGATG -3'
(R):5'- CCAAAGGCATATGTGACCCATC -3'

Sequencing Primer
(F):5'- TGAAAGACTGAGGAGGTCTACC -3'
(R):5'- TCACCCCAGACCTGAAGG -3'
Posted On 2021-08-02