Incidental Mutation 'R8911:Abca12'
ID 678591
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene Name ATP-binding cassette, sub-family A (ABC1), member 12
Synonyms 4833417A11Rik, 4832428G11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8911 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 71242276-71414910 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71341531 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 306 (D306G)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
AlphaFold E9Q876
Predicted Effect probably benign
Transcript: ENSMUST00000087268
AA Change: D306G

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: D306G

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
3425401B19Rik A T 14: 32,661,669 C780S possibly damaging Het
Agt T C 8: 124,564,445 Y41C probably benign Het
Alx3 G T 3: 107,604,287 R204L probably damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Bcl11a C T 11: 24,164,763 P702L probably damaging Het
Bpifa2 A G 2: 154,009,170 N17S probably benign Het
Cabcoco1 T C 10: 68,541,754 D35G probably benign Het
Cd69 T C 6: 129,275,224 K21R probably benign Het
Cntn4 T C 6: 106,353,782 probably null Het
Cntnap5c A C 17: 58,199,048 N689T probably damaging Het
Cog5 A G 12: 31,833,239 Y389C probably damaging Het
Col5a1 T C 2: 27,997,618 probably null Het
Coro1b G A 19: 4,150,804 R245Q probably damaging Het
Csmd1 T C 8: 16,698,003 D244G probably damaging Het
Ctcfl C T 2: 173,095,328 probably null Het
Dpy19l4 G A 4: 11,317,078 P40L possibly damaging Het
Dsg4 C A 18: 20,451,872 Y214* probably null Het
Fmo6 T C 1: 162,920,545 T317A possibly damaging Het
Fuca1 ATGCTGCTGCTGCTGCTGCTGCTGCT ATGCTGCTGCTGCTGCTGCTGCT 4: 135,920,804 probably benign Het
Gm11595 A G 11: 99,772,738 C39R unknown Het
Gm281 T C 14: 13,823,796 probably null Het
Greb1 G A 12: 16,690,902 S1393L possibly damaging Het
Guca1b A G 17: 47,389,119 I73V probably benign Het
Hdac7 C T 15: 97,796,908 V796I possibly damaging Het
Hectd1 A G 12: 51,748,833 I2271T probably damaging Het
Heg1 T G 16: 33,738,257 Y1066* probably null Het
Helz2 C A 2: 181,238,380 K514N Het
Ice1 C T 13: 70,592,668 R70Q Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Itgae A G 11: 73,113,621 T245A probably damaging Het
Jhy G A 9: 40,911,157 Q562* probably null Het
Khnyn A G 14: 55,887,278 R330G probably benign Het
Lamc2 A T 1: 153,152,127 C184S probably damaging Het
Lhx5 T A 5: 120,436,444 L271* probably null Het
Magel2 G A 7: 62,379,789 V814M unknown Het
Manf A G 9: 106,890,262 I85T possibly damaging Het
Mgmt A G 7: 137,128,065 T203A probably benign Het
Mmp9 C T 2: 164,952,648 S520F possibly damaging Het
Myrip A G 9: 120,441,418 E578G possibly damaging Het
Naaladl2 A G 3: 23,846,593 M691T probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Olfr1217 T C 2: 89,023,950 N18D probably benign Het
Olfr1222 T C 2: 89,125,264 I156V probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcdhga12 A T 18: 37,767,065 M317L possibly damaging Het
Pcnt T G 10: 76,387,525 K1941T probably damaging Het
Pde4dip A T 3: 97,743,601 M896K probably benign Het
Pfkfb3 A T 2: 11,482,443 probably null Het
Pik3cb A G 9: 99,064,148 S542P probably benign Het
Pik3cg A G 12: 32,197,258 V822A probably benign Het
Plcl2 G T 17: 50,608,113 G717C probably damaging Het
Ptprs C T 17: 56,423,320 A1185T probably benign Het
Ptpru T A 4: 131,776,249 I1157F probably damaging Het
Rbbp6 A G 7: 122,992,045 T457A possibly damaging Het
Rdh16f2 A G 10: 127,876,943 E270G probably damaging Het
Rrp15 C T 1: 186,721,444 E269K unknown Het
Sec23b T C 2: 144,559,396 V59A probably benign Het
Slc22a21 A T 11: 53,955,983 probably null Het
Sp5 C A 2: 70,476,618 P216T probably benign Het
Synj1 A T 16: 90,978,734 D385E probably damaging Het
Trim37 C T 11: 87,206,803 S808F possibly damaging Het
Tsks A T 7: 44,943,270 probably benign Het
Upf1 A T 8: 70,338,437 S563T possibly damaging Het
Upf2 A G 2: 5,983,082 D580G unknown Het
Usp14 A G 18: 9,996,194 I462T probably damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn1r184 C G 7: 26,266,885 Q19E possibly damaging Het
Vps50 C A 6: 3,516,710 A64E probably benign Het
Zc3h11a T A 1: 133,638,601 N211I probably damaging Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Zfp729a A T 13: 67,619,942 S723T probably benign Het
Zmynd12 A T 4: 119,437,089 I88F probably damaging Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71303541 missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71353757 missense probably benign 0.00
IGL00813:Abca12 APN 1 71353762 critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71302733 missense probably damaging 1.00
IGL00921:Abca12 APN 1 71285729 missense probably damaging 1.00
IGL01011:Abca12 APN 1 71263632 missense probably benign 0.02
IGL01066:Abca12 APN 1 71353730 missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71314114 missense probably damaging 1.00
IGL01310:Abca12 APN 1 71284156 missense probably benign 0.00
IGL01360:Abca12 APN 1 71286489 missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71319886 missense probably benign 0.00
IGL01608:Abca12 APN 1 71259442 missense probably damaging 1.00
IGL01687:Abca12 APN 1 71267610 splice site probably benign
IGL01700:Abca12 APN 1 71280390 missense probably benign
IGL01723:Abca12 APN 1 71314168 missense probably benign 0.01
IGL01804:Abca12 APN 1 71276183 missense probably benign 0.01
IGL01982:Abca12 APN 1 71346698 missense probably benign 0.34
IGL02136:Abca12 APN 1 71247142 missense probably damaging 1.00
IGL02172:Abca12 APN 1 71302658 missense probably benign 0.09
IGL02222:Abca12 APN 1 71282886 missense probably benign 0.40
IGL02266:Abca12 APN 1 71268201 nonsense probably null
IGL02449:Abca12 APN 1 71401749 splice site probably null
IGL02471:Abca12 APN 1 71258198 missense probably benign 0.00
IGL02496:Abca12 APN 1 71288553 missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71294747 missense probably damaging 0.96
IGL02795:Abca12 APN 1 71288748 missense probably damaging 1.00
IGL03000:Abca12 APN 1 71321800 missense probably benign 0.01
IGL03031:Abca12 APN 1 71314024 missense probably benign 0.00
IGL03131:Abca12 APN 1 71346702 missense probably benign
IGL03260:Abca12 APN 1 71284099 missense probably damaging 1.00
IGL03324:Abca12 APN 1 71314008 missense probably benign
IGL03408:Abca12 APN 1 71264795 missense probably damaging 1.00
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0121:Abca12 UTSW 1 71259786 splice site probably null
R0172:Abca12 UTSW 1 71279402 missense probably damaging 0.99
R0196:Abca12 UTSW 1 71259813 missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71259776 splice site probably benign
R0466:Abca12 UTSW 1 71302663 missense probably damaging 1.00
R0616:Abca12 UTSW 1 71302671 missense probably damaging 1.00
R0668:Abca12 UTSW 1 71263614 missense probably damaging 1.00
R0928:Abca12 UTSW 1 71349174 missense probably benign 0.06
R1036:Abca12 UTSW 1 71263410 critical splice donor site probably null
R1086:Abca12 UTSW 1 71295061 splice site probably benign
R1300:Abca12 UTSW 1 71244808 missense probably damaging 1.00
R1337:Abca12 UTSW 1 71294819 missense probably benign 0.03
R1356:Abca12 UTSW 1 71302953 splice site probably benign
R1372:Abca12 UTSW 1 71294857 missense probably damaging 1.00
R1434:Abca12 UTSW 1 71309800 missense probably benign 0.00
R1580:Abca12 UTSW 1 71265965 missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71263411 critical splice donor site probably null
R1773:Abca12 UTSW 1 71288596 missense probably damaging 1.00
R1829:Abca12 UTSW 1 71295029 missense probably benign 0.26
R1922:Abca12 UTSW 1 71319924 missense probably benign 0.10
R1927:Abca12 UTSW 1 71244840 missense probably damaging 1.00
R2115:Abca12 UTSW 1 71244771 missense probably benign 0.01
R2146:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2148:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2149:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2150:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2299:Abca12 UTSW 1 71258222 missense probably damaging 1.00
R2392:Abca12 UTSW 1 71258105 missense probably damaging 1.00
R2571:Abca12 UTSW 1 71249885 missense probably benign 0.00
R3077:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3078:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3705:Abca12 UTSW 1 71285705 missense probably damaging 1.00
R3800:Abca12 UTSW 1 71265887 missense probably damaging 1.00
R3905:Abca12 UTSW 1 71268230 missense possibly damaging 0.79
R3905:Abca12 UTSW 1 71279457 missense probably benign 0.02
R3962:Abca12 UTSW 1 71274515 splice site probably null
R4082:Abca12 UTSW 1 71267463 missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71319871 critical splice donor site probably null
R4214:Abca12 UTSW 1 71288697 missense probably damaging 0.99
R4403:Abca12 UTSW 1 71267436 missense probably damaging 1.00
R4524:Abca12 UTSW 1 71302917 missense probably benign 0.19
R4615:Abca12 UTSW 1 71330334 missense probably benign
R4617:Abca12 UTSW 1 71330334 missense probably benign
R4714:Abca12 UTSW 1 71321450 missense probably benign 0.00
R4809:Abca12 UTSW 1 71278856 missense probably benign 0.10
R4810:Abca12 UTSW 1 71303612 missense probably benign 0.00
R4825:Abca12 UTSW 1 71302685 missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71294939 missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71264767 missense probably damaging 0.99
R5026:Abca12 UTSW 1 71317224 missense probably benign 0.04
R5064:Abca12 UTSW 1 71300960 missense probably damaging 1.00
R5188:Abca12 UTSW 1 71291492 missense probably benign 0.23
R5234:Abca12 UTSW 1 71263664 missense probably damaging 0.99
R5267:Abca12 UTSW 1 71335774 splice site probably benign
R5302:Abca12 UTSW 1 71283952 missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71295056 missense probably damaging 1.00
R5451:Abca12 UTSW 1 71294917 missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71292446 missense probably benign 0.29
R5529:Abca12 UTSW 1 71264881 missense probably damaging 1.00
R5615:Abca12 UTSW 1 71307059 missense probably damaging 1.00
R5649:Abca12 UTSW 1 71291342 missense probably damaging 1.00
R5800:Abca12 UTSW 1 71321432 missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71303492 missense probably damaging 1.00
R5878:Abca12 UTSW 1 71346633 missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71258098 missense probably damaging 1.00
R6280:Abca12 UTSW 1 71272460 missense probably benign 0.04
R6316:Abca12 UTSW 1 71313959 missense probably benign 0.01
R6337:Abca12 UTSW 1 71295013 missense probably damaging 1.00
R6383:Abca12 UTSW 1 71247184 missense probably benign 0.03
R6564:Abca12 UTSW 1 71309850 missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71258225 missense probably benign 0.00
R6756:Abca12 UTSW 1 71259353 splice site probably null
R6876:Abca12 UTSW 1 71263508 missense probably damaging 0.98
R6999:Abca12 UTSW 1 71317162 nonsense probably null
R7145:Abca12 UTSW 1 71307053 missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71248432 missense probably damaging 0.99
R7285:Abca12 UTSW 1 71349155 nonsense probably null
R7421:Abca12 UTSW 1 71247136 nonsense probably null
R7531:Abca12 UTSW 1 71247173 missense probably damaging 0.99
R7592:Abca12 UTSW 1 71288677 missense probably benign 0.01
R7687:Abca12 UTSW 1 71258182 missense probably benign 0.00
R7690:Abca12 UTSW 1 71314154 missense probably benign 0.00
R7709:Abca12 UTSW 1 71335728 missense probably benign 0.00
R7736:Abca12 UTSW 1 71319964 missense probably benign 0.01
R7754:Abca12 UTSW 1 71302887 missense probably benign
R7761:Abca12 UTSW 1 71330288 missense probably damaging 1.00
R7808:Abca12 UTSW 1 71274634 splice site probably null
R7816:Abca12 UTSW 1 71292429 missense probably benign 0.01
R7821:Abca12 UTSW 1 71259791 missense probably benign 0.12
R7827:Abca12 UTSW 1 71414678 start gained probably benign
R7829:Abca12 UTSW 1 71292421 missense probably benign 0.37
R7863:Abca12 UTSW 1 71293497 missense probably damaging 0.96
R8053:Abca12 UTSW 1 71349169 nonsense probably null
R8093:Abca12 UTSW 1 71280393 missense probably benign 0.00
R8120:Abca12 UTSW 1 71259381 missense possibly damaging 0.92
R8136:Abca12 UTSW 1 71248397 missense probably benign 0.15
R8155:Abca12 UTSW 1 71291338 missense probably damaging 1.00
R8189:Abca12 UTSW 1 71285726 missense probably damaging 1.00
R8233:Abca12 UTSW 1 71351757 missense probably benign 0.00
R8249:Abca12 UTSW 1 71321812 missense probably benign 0.00
R8255:Abca12 UTSW 1 71319899 missense probably benign 0.13
R8300:Abca12 UTSW 1 71313964 missense possibly damaging 0.77
R8339:Abca12 UTSW 1 71285672 missense probably damaging 1.00
R8490:Abca12 UTSW 1 71284097 missense probably damaging 1.00
R8494:Abca12 UTSW 1 71288662 missense probably benign 0.02
R8527:Abca12 UTSW 1 71309888 critical splice acceptor site probably null
R8542:Abca12 UTSW 1 71309888 critical splice acceptor site probably null
R8692:Abca12 UTSW 1 71288715 missense probably damaging 0.96
R8723:Abca12 UTSW 1 71321738 missense probably benign 0.04
R8796:Abca12 UTSW 1 71258089 critical splice donor site probably benign
R8913:Abca12 UTSW 1 71264813 missense probably damaging 1.00
R8957:Abca12 UTSW 1 71321625 missense possibly damaging 0.90
R9000:Abca12 UTSW 1 71314036 missense probably damaging 1.00
R9137:Abca12 UTSW 1 71259366 missense possibly damaging 0.80
R9228:Abca12 UTSW 1 71293440 missense probably damaging 1.00
R9237:Abca12 UTSW 1 71279398 missense probably damaging 0.97
R9299:Abca12 UTSW 1 71319883 missense possibly damaging 0.48
R9419:Abca12 UTSW 1 71303490 missense possibly damaging 0.81
X0013:Abca12 UTSW 1 71248433 missense probably damaging 0.99
X0018:Abca12 UTSW 1 71314510 missense probably benign
X0063:Abca12 UTSW 1 71349064 missense probably benign 0.15
X0065:Abca12 UTSW 1 71341461 critical splice donor site probably null
Z1176:Abca12 UTSW 1 71284070 missense probably damaging 1.00
Z1177:Abca12 UTSW 1 71276082 missense possibly damaging 0.94
Z1177:Abca12 UTSW 1 71282811 missense probably damaging 0.98
Z1177:Abca12 UTSW 1 71292531 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGTGATTTTGTACAGTAAGAGAGC -3'
(R):5'- TGGGAGATTTTGTGCATGAATAGAC -3'

Sequencing Primer
(F):5'- ACATTTCCCTCTGTGTGTATGTG -3'
(R):5'- TTAAATTACAAAAGCAGCATCTTGTC -3'
Posted On 2021-08-02