Incidental Mutation 'R8911:Pde4dip'
ID678608
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8911 (G1)
Quality Score175.009
Status Not validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97743601 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 896 (M896K)
Ref Sequence ENSEMBL: ENSMUSP00000088254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045243] [ENSMUST00000090750] [ENSMUST00000107038] [ENSMUST00000168438] [ENSMUST00000175751]
Predicted Effect probably damaging
Transcript: ENSMUST00000045243
AA Change: M939K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040905
Gene: ENSMUSG00000038170
AA Change: M939K

DomainStartEndE-ValueType
low complexity region 72 90 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
coiled coil region 399 451 N/A INTRINSIC
SCOP:d1gw5a_ 613 839 3e-3 SMART
coiled coil region 909 985 N/A INTRINSIC
low complexity region 1081 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090750
AA Change: M896K

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: M896K

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107038
SMART Domains Protein: ENSMUSP00000102653
Gene: ENSMUSG00000038170

DomainStartEndE-ValueType
Pfam:Microtub_assoc 70 144 7.8e-32 PFAM
low complexity region 150 165 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
internal_repeat_1 343 384 5.54e-5 PROSPERO
low complexity region 513 524 N/A INTRINSIC
internal_repeat_1 566 607 5.54e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000168438
AA Change: M896K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: M896K

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175751
SMART Domains Protein: ENSMUSP00000134832
Gene: ENSMUSG00000038170

DomainStartEndE-ValueType
Pfam:zf-AD 4 78 4.3e-8 PFAM
low complexity region 159 170 N/A INTRINSIC
coiled coil region 399 451 N/A INTRINSIC
coiled coil region 513 538 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
3425401B19Rik A T 14: 32,661,669 C780S possibly damaging Het
Abca12 T C 1: 71,341,531 D306G probably benign Het
Agt T C 8: 124,564,445 Y41C probably benign Het
Alx3 G T 3: 107,604,287 R204L probably damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Bcl11a C T 11: 24,164,763 P702L probably damaging Het
Bpifa2 A G 2: 154,009,170 N17S probably benign Het
Cabcoco1 T C 10: 68,541,754 D35G probably benign Het
Cd69 T C 6: 129,275,224 K21R probably benign Het
Cntn4 T C 6: 106,353,782 probably null Het
Cntnap5c A C 17: 58,199,048 N689T probably damaging Het
Cog5 A G 12: 31,833,239 Y389C probably damaging Het
Col5a1 T C 2: 27,997,618 probably null Het
Coro1b G A 19: 4,150,804 R245Q probably damaging Het
Csmd1 T C 8: 16,698,003 D244G probably damaging Het
Ctcfl C T 2: 173,095,328 probably null Het
Dpy19l4 G A 4: 11,317,078 P40L possibly damaging Het
Dsg4 C A 18: 20,451,872 Y214* probably null Het
Fmo6 T C 1: 162,920,545 T317A possibly damaging Het
Fuca1 ATGCTGCTGCTGCTGCTGCTGCTGCT ATGCTGCTGCTGCTGCTGCTGCT 4: 135,920,804 probably benign Het
Gm11595 A G 11: 99,772,738 C39R unknown Het
Gm281 T C 14: 13,823,796 probably null Het
Greb1 G A 12: 16,690,902 S1393L possibly damaging Het
Guca1b A G 17: 47,389,119 I73V probably benign Het
Hdac7 C T 15: 97,796,908 V796I possibly damaging Het
Hectd1 A G 12: 51,748,833 I2271T probably damaging Het
Heg1 T G 16: 33,738,257 Y1066* probably null Het
Helz2 C A 2: 181,238,380 K514N Het
Ice1 C T 13: 70,592,668 R70Q Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Itgae A G 11: 73,113,621 T245A probably damaging Het
Jhy G A 9: 40,911,157 Q562* probably null Het
Khnyn A G 14: 55,887,278 R330G probably benign Het
Lamc2 A T 1: 153,152,127 C184S probably damaging Het
Lhx5 T A 5: 120,436,444 L271* probably null Het
Magel2 G A 7: 62,379,789 V814M unknown Het
Manf A G 9: 106,890,262 I85T possibly damaging Het
Mgmt A G 7: 137,128,065 T203A probably benign Het
Mmp9 C T 2: 164,952,648 S520F possibly damaging Het
Myrip A G 9: 120,441,418 E578G possibly damaging Het
Naaladl2 A G 3: 23,846,593 M691T probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Olfr1217 T C 2: 89,023,950 N18D probably benign Het
Olfr1222 T C 2: 89,125,264 I156V probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcdhga12 A T 18: 37,767,065 M317L possibly damaging Het
Pcnt T G 10: 76,387,525 K1941T probably damaging Het
Pfkfb3 A T 2: 11,482,443 probably null Het
Pik3cb A G 9: 99,064,148 S542P probably benign Het
Pik3cg A G 12: 32,197,258 V822A probably benign Het
Plcl2 G T 17: 50,608,113 G717C probably damaging Het
Ptprs C T 17: 56,423,320 A1185T probably benign Het
Ptpru T A 4: 131,776,249 I1157F probably damaging Het
Rbbp6 A G 7: 122,992,045 T457A possibly damaging Het
Rdh16f2 A G 10: 127,876,943 E270G probably damaging Het
Rrp15 C T 1: 186,721,444 E269K unknown Het
Sec23b T C 2: 144,559,396 V59A probably benign Het
Slc22a21 A T 11: 53,955,983 probably null Het
Sp5 C A 2: 70,476,618 P216T probably benign Het
Synj1 A T 16: 90,978,734 D385E probably damaging Het
Trim37 C T 11: 87,206,803 S808F possibly damaging Het
Tsks A T 7: 44,943,270 probably benign Het
Upf1 A T 8: 70,338,437 S563T possibly damaging Het
Upf2 A G 2: 5,983,082 D580G unknown Het
Usp14 A G 18: 9,996,194 I462T probably damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn1r184 C G 7: 26,266,885 Q19E possibly damaging Het
Vps50 C A 6: 3,516,710 A64E probably benign Het
Zc3h11a T A 1: 133,638,601 N211I probably damaging Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Zfp729a A T 13: 67,619,942 S723T probably benign Het
Zmynd12 A T 4: 119,437,089 I88F probably damaging Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
R7354:Pde4dip UTSW 3 97719330 missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97715541 missense probably benign 0.01
R7360:Pde4dip UTSW 3 97718316 missense probably benign 0.01
R7371:Pde4dip UTSW 3 97757271 missense probably benign 0.08
R7432:Pde4dip UTSW 3 97695092 missense probably benign
R7536:Pde4dip UTSW 3 97757244 missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97766655 missense possibly damaging 0.59
R7609:Pde4dip UTSW 3 97715565 missense possibly damaging 0.85
R7650:Pde4dip UTSW 3 97699107 critical splice donor site probably null
R7800:Pde4dip UTSW 3 97715283 missense probably damaging 1.00
R7846:Pde4dip UTSW 3 97715174 missense probably damaging 1.00
R7918:Pde4dip UTSW 3 97715223 nonsense probably null
R8120:Pde4dip UTSW 3 97706938 missense probably null 0.94
R8139:Pde4dip UTSW 3 97696993 missense probably benign 0.02
R8144:Pde4dip UTSW 3 97715426 missense probably damaging 1.00
R8177:Pde4dip UTSW 3 97767532 missense probably damaging 0.98
R8294:Pde4dip UTSW 3 97767378 missense probably damaging 1.00
R8406:Pde4dip UTSW 3 97699112 missense probably benign 0.04
R8912:Pde4dip UTSW 3 97710317 missense probably damaging 1.00
R8960:Pde4dip UTSW 3 97793148 missense probably damaging 1.00
R8993:Pde4dip UTSW 3 97766494 missense probably damaging 1.00
R9031:Pde4dip UTSW 3 97692359 missense probably damaging 1.00
R9032:Pde4dip UTSW 3 97694069 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCTGTAGACAGCTGAACTAC -3'
(R):5'- TGTGTTAGCGGAGGCATTAAC -3'

Sequencing Primer
(F):5'- CTGTAGACAGCTGAACTACAAGCTG -3'
(R):5'- TGTGTTAGCGGAGGCATTAACATAAC -3'
Posted On2021-08-02