Incidental Mutation 'R8911:Ice1'
ID 678646
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock # R8911 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 70551707-70637634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70592668 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 70 (R70Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637]
AlphaFold E9Q286
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: R2140Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: R2140Q

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
3425401B19Rik A T 14: 32,661,669 C780S possibly damaging Het
Abca12 T C 1: 71,341,531 D306G probably benign Het
Agt T C 8: 124,564,445 Y41C probably benign Het
Alx3 G T 3: 107,604,287 R204L probably damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Bcl11a C T 11: 24,164,763 P702L probably damaging Het
Bpifa2 A G 2: 154,009,170 N17S probably benign Het
Cabcoco1 T C 10: 68,541,754 D35G probably benign Het
Cd69 T C 6: 129,275,224 K21R probably benign Het
Cntn4 T C 6: 106,353,782 probably null Het
Cntnap5c A C 17: 58,199,048 N689T probably damaging Het
Cog5 A G 12: 31,833,239 Y389C probably damaging Het
Col5a1 T C 2: 27,997,618 probably null Het
Coro1b G A 19: 4,150,804 R245Q probably damaging Het
Csmd1 T C 8: 16,698,003 D244G probably damaging Het
Ctcfl C T 2: 173,095,328 probably null Het
Dpy19l4 G A 4: 11,317,078 P40L possibly damaging Het
Dsg4 C A 18: 20,451,872 Y214* probably null Het
Fmo6 T C 1: 162,920,545 T317A possibly damaging Het
Fuca1 ATGCTGCTGCTGCTGCTGCTGCTGCT ATGCTGCTGCTGCTGCTGCTGCT 4: 135,920,804 probably benign Het
Gm11595 A G 11: 99,772,738 C39R unknown Het
Gm281 T C 14: 13,823,796 probably null Het
Greb1 G A 12: 16,690,902 S1393L possibly damaging Het
Guca1b A G 17: 47,389,119 I73V probably benign Het
Hdac7 C T 15: 97,796,908 V796I possibly damaging Het
Hectd1 A G 12: 51,748,833 I2271T probably damaging Het
Heg1 T G 16: 33,738,257 Y1066* probably null Het
Helz2 C A 2: 181,238,380 K514N Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Itgae A G 11: 73,113,621 T245A probably damaging Het
Jhy G A 9: 40,911,157 Q562* probably null Het
Khnyn A G 14: 55,887,278 R330G probably benign Het
Lamc2 A T 1: 153,152,127 C184S probably damaging Het
Lhx5 T A 5: 120,436,444 L271* probably null Het
Magel2 G A 7: 62,379,789 V814M unknown Het
Manf A G 9: 106,890,262 I85T possibly damaging Het
Mgmt A G 7: 137,128,065 T203A probably benign Het
Mmp9 C T 2: 164,952,648 S520F possibly damaging Het
Myrip A G 9: 120,441,418 E578G possibly damaging Het
Naaladl2 A G 3: 23,846,593 M691T probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Olfr1217 T C 2: 89,023,950 N18D probably benign Het
Olfr1222 T C 2: 89,125,264 I156V probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcdhga12 A T 18: 37,767,065 M317L possibly damaging Het
Pcnt T G 10: 76,387,525 K1941T probably damaging Het
Pde4dip A T 3: 97,743,601 M896K probably benign Het
Pfkfb3 A T 2: 11,482,443 probably null Het
Pik3cb A G 9: 99,064,148 S542P probably benign Het
Pik3cg A G 12: 32,197,258 V822A probably benign Het
Plcl2 G T 17: 50,608,113 G717C probably damaging Het
Ptprs C T 17: 56,423,320 A1185T probably benign Het
Ptpru T A 4: 131,776,249 I1157F probably damaging Het
Rbbp6 A G 7: 122,992,045 T457A possibly damaging Het
Rdh16f2 A G 10: 127,876,943 E270G probably damaging Het
Rrp15 C T 1: 186,721,444 E269K unknown Het
Sec23b T C 2: 144,559,396 V59A probably benign Het
Slc22a21 A T 11: 53,955,983 probably null Het
Sp5 C A 2: 70,476,618 P216T probably benign Het
Synj1 A T 16: 90,978,734 D385E probably damaging Het
Trim37 C T 11: 87,206,803 S808F possibly damaging Het
Tsks A T 7: 44,943,270 probably benign Het
Upf1 A T 8: 70,338,437 S563T possibly damaging Het
Upf2 A G 2: 5,983,082 D580G unknown Het
Usp14 A G 18: 9,996,194 I462T probably damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn1r184 C G 7: 26,266,885 Q19E possibly damaging Het
Vps50 C A 6: 3,516,710 A64E probably benign Het
Zc3h11a T A 1: 133,638,601 N211I probably damaging Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Zfp729a A T 13: 67,619,942 S723T probably benign Het
Zmynd12 A T 4: 119,437,089 I88F probably damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 splice site probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
R8444:Ice1 UTSW 13 70604376 missense probably damaging 1.00
R8474:Ice1 UTSW 13 70604447 missense probably benign 0.42
R8751:Ice1 UTSW 13 70602891 missense probably damaging 1.00
R8887:Ice1 UTSW 13 70602931 missense probably damaging 1.00
R8954:Ice1 UTSW 13 70610578 missense probably damaging 1.00
R9345:Ice1 UTSW 13 70592639 missense
R9438:Ice1 UTSW 13 70606315 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAACTGACCCTTGAAGATAC -3'
(R):5'- CAGCTGTCTCACTGAGTGGTAG -3'

Sequencing Primer
(F):5'- CACATGAATTTAAGTTGGAAGGACTG -3'
(R):5'- TGGTAGCCCACACTGCAC -3'
Posted On 2021-08-02