Incidental Mutation 'R8911:Dsg4'
ID 678660
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms lah, CDHF13
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock # R8911 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20436175-20471821 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 20451872 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 214 (Y214*)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably null
Transcript: ENSMUST00000019426
AA Change: Y214*
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: Y214*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Meta Mutation Damage Score 0.9667 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,281,115 I774F probably benign Het
3425401B19Rik A T 14: 32,661,669 C780S possibly damaging Het
Abca12 T C 1: 71,341,531 D306G probably benign Het
Adgrl2 T C 3: 148,852,527 probably benign Het
Agt T C 8: 124,564,445 Y41C probably benign Het
Alx3 G T 3: 107,604,287 R204L probably damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Bcl11a C T 11: 24,164,763 P702L probably damaging Het
Bpifa2 A G 2: 154,009,170 N17S probably benign Het
Cabcoco1 T C 10: 68,541,754 D35G probably benign Het
Cd69 T C 6: 129,275,224 K21R probably benign Het
Cntn4 T C 6: 106,353,782 probably null Het
Cntnap5c A C 17: 58,199,048 N689T probably damaging Het
Cog5 A G 12: 31,833,239 Y389C probably damaging Het
Col5a1 T C 2: 27,997,618 probably null Het
Coro1b G A 19: 4,150,804 R245Q probably damaging Het
Csmd1 T C 8: 16,698,003 D244G probably damaging Het
Ctcfl C T 2: 173,095,328 probably null Het
Dpy19l4 G A 4: 11,317,078 P40L possibly damaging Het
Eapp A T 12: 54,692,655 probably benign Het
Fmo6 T C 1: 162,920,545 T317A possibly damaging Het
Gm11595 A G 11: 99,772,738 C39R unknown Het
Gm281 T C 14: 13,823,796 probably null Het
Golim4 T C 3: 75,906,396 probably benign Het
Greb1 G A 12: 16,690,902 S1393L possibly damaging Het
Guca1b A G 17: 47,389,119 I73V probably benign Het
Hdac7 C T 15: 97,796,908 V796I possibly damaging Het
Hectd1 A G 12: 51,748,833 I2271T probably damaging Het
Heg1 T G 16: 33,738,257 Y1066* probably null Het
Helz2 C A 2: 181,238,380 K514N Het
Ice1 C T 13: 70,592,668 R70Q Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Itgae A G 11: 73,113,621 T245A probably damaging Het
Jhy G A 9: 40,911,157 Q562* probably null Het
Khnyn A G 14: 55,887,278 R330G probably benign Het
Lamc2 A T 1: 153,152,127 C184S probably damaging Het
Lhx5 T A 5: 120,436,444 L271* probably null Het
Magel2 G A 7: 62,379,789 V814M unknown Het
Manf A G 9: 106,890,262 I85T possibly damaging Het
Mgmt A G 7: 137,128,065 T203A probably benign Het
Mmp9 C T 2: 164,952,648 S520F possibly damaging Het
Myrip A G 9: 120,441,418 E578G possibly damaging Het
Naaladl2 A G 3: 23,846,593 M691T probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Olfr1217 T C 2: 89,023,950 N18D probably benign Het
Olfr1222 T C 2: 89,125,264 I156V probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcdhga12 A T 18: 37,767,065 M317L possibly damaging Het
Pcnt T G 10: 76,387,525 K1941T probably damaging Het
Pde4dip A T 3: 97,743,601 M896K probably benign Het
Pfkfb3 A T 2: 11,482,443 probably null Het
Pik3cb A G 9: 99,064,148 S542P probably benign Het
Pik3cg A G 12: 32,197,258 V822A probably benign Het
Plcl2 G T 17: 50,608,113 G717C probably damaging Het
Ptprs C T 17: 56,423,320 A1185T probably benign Het
Ptpru T A 4: 131,776,249 I1157F probably damaging Het
Rbbp6 A G 7: 122,992,045 T457A possibly damaging Het
Rdh16f2 A G 10: 127,876,943 E270G probably damaging Het
Rrp15 C T 1: 186,721,444 E269K unknown Het
Sec23b T C 2: 144,559,396 V59A probably benign Het
Slc22a21 A T 11: 53,955,983 probably null Het
Sp5 C A 2: 70,476,618 P216T probably benign Het
Synj1 A T 16: 90,978,734 D385E probably damaging Het
Trim37 C T 11: 87,206,803 S808F possibly damaging Het
Tsks A T 7: 44,943,270 probably benign Het
Upf1 A T 8: 70,338,437 S563T possibly damaging Het
Upf2 A G 2: 5,983,082 D580G unknown Het
Usp14 A G 18: 9,996,194 I462T probably damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn1r184 C G 7: 26,266,885 Q19E possibly damaging Het
Vps50 C A 6: 3,516,710 A64E probably benign Het
Zc3h11a T A 1: 133,638,601 N211I probably damaging Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Zfp729a A T 13: 67,619,942 S723T probably benign Het
Zmynd12 A T 4: 119,437,089 I88F probably damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
woodshed UTSW 18 20451872 nonsense probably null
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 splice site probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20471164 missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20449731 missense probably benign 0.31
R8554:Dsg4 UTSW 18 20453043 missense probably damaging 1.00
R9059:Dsg4 UTSW 18 20471125 missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20471013 missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20452990 missense probably benign 0.00
R9765:Dsg4 UTSW 18 20471277 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTTATACCTAATGCCTGGAGGG -3'
(R):5'- AGGTGCATAAAACGAAATCTGTATC -3'

Sequencing Primer
(F):5'- ATGCCTGGAGGGATTGAATC -3'
(R):5'- TAAAACGAAATCTGTATCACTGACC -3'
Posted On 2021-08-02