Incidental Mutation 'R8912:Trpm1'
ID 678690
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8912 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 64153835-64269775 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 64268880 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1540 (R1540L)
Ref Sequence ENSEMBL: ENSMUSP00000082318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]
AlphaFold Q2TV84
Predicted Effect probably benign
Transcript: ENSMUST00000085222
AA Change: R1540L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: R1540L

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000206263
AA Change: R1424L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000206277
AA Change: R1546L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206314
AA Change: R656L

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000206848
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik C T 5: 113,723,706 W34* probably null Het
Adck5 T C 15: 76,593,235 S90P probably damaging Het
Adgra3 C A 5: 49,960,931 A1092S possibly damaging Het
Arhgap33 A T 7: 30,533,042 probably benign Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atp6ap1l T A 13: 90,898,860 probably null Het
BC022687 T C 12: 112,815,703 V320A possibly damaging Het
Brd2 A T 17: 34,113,484 probably benign Het
Cfap46 A T 7: 139,680,181 probably benign Het
Ciao1 A G 2: 127,246,679 V108A possibly damaging Het
Dnah3 T A 7: 120,090,646 H22L probably benign Het
Dnajc6 A G 4: 101,611,316 Y251C probably damaging Het
Dsg2 T A 18: 20,582,821 N273K probably damaging Het
Egf A G 3: 129,737,515 V137A possibly damaging Het
Ercc6 C T 14: 32,526,254 P254L probably benign Het
Erh G T 12: 80,637,508 A65E probably benign Het
Fbln2 A G 6: 91,263,438 E789G possibly damaging Het
Fbxl13 T G 5: 21,522,186 D571A probably damaging Het
Fbxw26 T A 9: 109,732,649 E159V probably damaging Het
Fndc1 T C 17: 7,800,946 I134V probably null Het
Fsip2 A G 2: 82,980,594 D2419G probably benign Het
Gm15448 A T 7: 3,822,819 D350E unknown Het
Gm3371 T C 14: 44,403,781 K109E Het
Gm5414 A G 15: 101,628,185 S2P possibly damaging Het
Igkv1-110 G T 6: 68,270,966 D20Y probably damaging Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Ippk A G 13: 49,450,037 D422G probably damaging Het
Irs2 A T 8: 11,006,655 D592E probably damaging Het
Klra9 A G 6: 130,182,405 I215T probably damaging Het
Lrrc8b T A 5: 105,481,558 L590Q probably damaging Het
Myh10 A G 11: 68,790,103 probably null Het
Neto1 A G 18: 86,461,048 D159G probably damaging Het
Nr1d2 T C 14: 18,220,030 K104E probably damaging Het
Nrcam T C 12: 44,598,583 V1256A probably damaging Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Olfr1160 C T 2: 88,006,317 A145T possibly damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr187 A G 16: 59,035,900 V279A probably benign Het
Olfr70 T A 4: 43,697,017 D52V probably benign Het
Patj A G 4: 98,497,328 H444R Het
Pclo T C 5: 14,775,321 L1356P Het
Pde4dip A G 3: 97,710,317 S1732P probably damaging Het
Pi4ka A T 16: 17,389,366 I25N Het
Pou2f3 C A 9: 43,199,039 V30L probably benign Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Reck T A 4: 43,938,802 probably benign Het
Sdha A T 13: 74,327,204 probably benign Het
Serinc1 A C 10: 57,523,979 S191A probably benign Het
Sgo2a T C 1: 58,017,401 S915P probably damaging Het
Sgsh T C 11: 119,352,660 T79A probably damaging Het
Sik1 A G 17: 31,850,945 V207A possibly damaging Het
Skap1 A T 11: 96,754,076 I338F probably damaging Het
Sowahc G T 10: 59,221,991 probably benign Het
Spata31d1d T C 13: 59,727,322 K800E possibly damaging Het
Spin1 T A 13: 51,144,397 W151R probably damaging Het
Srfbp1 A G 18: 52,490,614 T438A possibly damaging Het
Srrm2 A G 17: 23,819,601 T1740A probably benign Het
Tacr1 A T 6: 82,557,033 S347C probably damaging Het
Taf1b T C 12: 24,516,861 S185P possibly damaging Het
Tanc2 C T 11: 105,867,327 T638I probably benign Het
Tdrkh T C 3: 94,429,171 Y472H probably damaging Het
Trav4-2 C G 14: 53,418,809 Y89* probably null Het
Ttc21a T C 9: 119,941,301 probably null Het
Ttc37 T A 13: 76,157,242 probably benign Het
Tti1 A G 2: 158,009,268 V17A probably benign Het
Vamp8 A G 6: 72,388,293 L44P probably benign Het
Vmn1r63 G T 7: 5,803,132 S167Y probably damaging Het
Xrn2 T C 2: 147,049,993 V710A probably benign Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Zfyve28 T C 5: 34,217,311 D453G probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 64268561 missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 64199250 intron probably benign
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0445:Trpm1 UTSW 7 64244842 unclassified probably benign
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 splice site probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 64240535 missense probably damaging 1.00
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1864:Trpm1 UTSW 7 64268016 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4490:Trpm1 UTSW 7 64208912 nonsense probably null
R4666:Trpm1 UTSW 7 64203034 missense probably damaging 1.00
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4781:Trpm1 UTSW 7 64235052 missense probably benign 0.30
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6380:Trpm1 UTSW 7 64268297 missense probably benign 0.24
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6939:Trpm1 UTSW 7 64268297 missense probably benign 0.03
R6944:Trpm1 UTSW 7 64243433 missense probably damaging 1.00
R7025:Trpm1 UTSW 7 64226714 critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 64235845 missense probably damaging 0.97
R7168:Trpm1 UTSW 7 64268697 missense probably benign 0.01
R7219:Trpm1 UTSW 7 64204585 missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 64219106 critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 64209981 nonsense probably null
R7367:Trpm1 UTSW 7 64268801 missense probably benign 0.06
R7449:Trpm1 UTSW 7 64208975 missense probably benign 0.14
R7466:Trpm1 UTSW 7 64240582 missense probably damaging 0.99
R7498:Trpm1 UTSW 7 64208909 missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 64204555 missense probably benign 0.00
R7776:Trpm1 UTSW 7 64248191 missense probably benign 0.04
R8062:Trpm1 UTSW 7 64201941 missense probably benign 0.18
R8069:Trpm1 UTSW 7 64208970 missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 64199269 missense probably damaging 1.00
R8219:Trpm1 UTSW 7 64201951 missense probably benign 0.35
R8258:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8259:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8320:Trpm1 UTSW 7 64268793 missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 64247407 missense probably damaging 1.00
R8544:Trpm1 UTSW 7 64224608 splice site probably null
R8813:Trpm1 UTSW 7 64202008 missense possibly damaging 0.68
R8954:Trpm1 UTSW 7 64208341 missense probably damaging 0.98
R9139:Trpm1 UTSW 7 64199195 missense probably benign 0.00
R9205:Trpm1 UTSW 7 64240571 missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 64234965 missense probably benign 0.01
R9283:Trpm1 UTSW 7 64223875 missense probably benign 0.18
R9394:Trpm1 UTSW 7 64268732 missense probably benign 0.00
R9430:Trpm1 UTSW 7 64223698 missense probably benign 0.38
R9537:Trpm1 UTSW 7 64153868 unclassified probably benign
R9616:Trpm1 UTSW 7 64208384 missense probably damaging 0.99
R9774:Trpm1 UTSW 7 64248293 missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Z1176:Trpm1 UTSW 7 64203131 critical splice donor site probably null
Z1176:Trpm1 UTSW 7 64204594 critical splice donor site probably null
Z1177:Trpm1 UTSW 7 64217691 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAACTGGAGTGCAGAGTAC -3'
(R):5'- GTGTTTTGTCCCTCTGGAACAAC -3'

Sequencing Primer
(F):5'- TGCAGAGTACAGTTCAATCATGGAC -3'
(R):5'- CATAACTGCTAAGTTGCTAGTGCTGC -3'
Posted On 2021-08-02