Incidental Mutation 'R8913:Ror1'
ID 678752
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Name receptor tyrosine kinase-like orphan receptor 1
Synonyms 2810404D04Rik, Ntrkr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8913 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 100095791-100444765 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 100407830 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 167 (D167A)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
AlphaFold Q9Z139
Predicted Effect possibly damaging
Transcript: ENSMUST00000039630
AA Change: D167A

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: D167A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Meta Mutation Damage Score 0.1335 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,264,813 Y2102H probably damaging Het
Adam30 A T 3: 98,161,264 I10F possibly damaging Het
Afap1l1 C T 18: 61,756,839 probably null Het
Asz1 T C 6: 18,054,571 D411G probably benign Het
Atp8b2 A G 3: 89,945,523 L144P Het
Atxn7l3 G T 11: 102,294,961 N13K probably damaging Het
Cap1 C A 4: 122,867,652 probably null Het
Cd244 T A 1: 171,574,206 Y167N probably damaging Het
Cd244 A T 1: 171,574,207 Y167F probably damaging Het
Cd302 A G 2: 60,257,897 F92S probably damaging Het
Cep128 C T 12: 91,364,447 probably null Het
Csmd2 C A 4: 128,523,558 P2770T Het
Cyp4f40 G T 17: 32,667,836 D122Y probably benign Het
Dnah14 A G 1: 181,725,498 E2583G probably benign Het
Dync1h1 T C 12: 110,658,168 V3714A probably benign Het
Fam114a1 G T 5: 65,028,478 A381S possibly damaging Het
Fam208a A T 14: 27,466,188 N864Y probably damaging Het
Fzd8 A G 18: 9,213,869 Y317C probably damaging Het
Igfn1 T C 1: 135,963,841 K2312R possibly damaging Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Klhl23 G A 2: 69,833,890 E528K probably damaging Het
Lama4 T C 10: 39,106,043 V1756A probably benign Het
Lcn2 C A 2: 32,387,146 V53F possibly damaging Het
Lrp4 T C 2: 91,501,440 S1633P probably benign Het
Map3k19 A G 1: 127,822,626 V996A probably benign Het
Mettl9 T G 7: 121,076,316 F313C probably damaging Het
Mios T A 6: 8,215,924 H373Q probably benign Het
Mroh2b A G 15: 4,917,528 probably benign Het
Myo1a T C 10: 127,705,841 V83A probably benign Het
Naxe T C 3: 88,058,358 T45A probably benign Het
Nckap1 A G 2: 80,571,220 V40A possibly damaging Het
Nmt1 G T 11: 103,057,445 R265L probably damaging Het
Nwd2 C A 5: 63,806,097 A1008D possibly damaging Het
Obsl1 C T 1: 75,491,248 A1334T probably benign Het
Olfr1209 A G 2: 88,909,647 F249L probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1361 A G 13: 21,659,104 F73S probably damaging Het
Olfr517 A T 7: 108,868,602 V184E probably damaging Het
Olfr519 T C 7: 108,893,529 R298G probably damaging Het
Oplah T C 15: 76,297,480 M1114V Het
Pdlim5 A T 3: 142,244,905 F582L probably damaging Het
Plcb2 A G 2: 118,713,884 F671L probably damaging Het
Ppfibp1 T A 6: 147,022,449 V725E probably damaging Het
Psmd11 C T 11: 80,471,512 T396I probably damaging Het
Ptn C T 6: 36,741,341 D130N probably benign Het
Rasgrf2 T C 13: 92,022,526 D473G probably benign Het
Robo1 A C 16: 72,904,734 I163L probably damaging Het
Rps6ka5 T C 12: 100,554,336 D709G Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Runx2 T C 17: 44,608,282 T472A probably benign Het
Scn11a T C 9: 119,794,028 T582A probably damaging Het
Serpina3m C T 12: 104,389,218 A48V probably benign Het
Slc9a3r2 G A 17: 24,644,865 S12L probably benign Het
Smim8 T A 4: 34,769,056 D76V possibly damaging Het
Sqor A G 2: 122,799,886 K260R probably benign Het
Syde2 A T 3: 146,002,393 I963F probably damaging Het
Tenm4 G A 7: 96,702,745 probably benign Het
Tm7sf3 A T 6: 146,626,123 Y68* probably null Het
Tmtc2 T A 10: 105,323,026 I569F probably damaging Het
Upf3a G A 8: 13,795,728 V276M possibly damaging Het
Vmn1r174 G A 7: 23,753,950 V14M possibly damaging Het
Vmn2r104 A G 17: 20,029,706 S768P probably damaging Het
Vmn2r60 A T 7: 42,136,354 T194S probably benign Het
Zfhx2 A G 14: 55,072,086 M852T probably benign Het
Zfp207 T A 11: 80,385,918 D19E probably damaging Het
Zfp318 G A 17: 46,411,773 M1567I probably benign Het
Zfp407 T A 18: 84,560,528 E820V probably damaging Het
Zfp512b A T 2: 181,585,489 C46S Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0256:Ror1 UTSW 4 100409745 missense probably benign 0.20
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100441137 missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4871:Ror1 UTSW 4 100425998 missense probably benign
R4990:Ror1 UTSW 4 100441964 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5028:Ror1 UTSW 4 100411936 missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R6733:Ror1 UTSW 4 100426055 missense probably benign
R7022:Ror1 UTSW 4 100407911 missense probably damaging 1.00
R7054:Ror1 UTSW 4 100442239 missense probably benign 0.00
R7121:Ror1 UTSW 4 100302945 missense probably benign 0.00
R7350:Ror1 UTSW 4 100425943 missense probably benign 0.00
R7492:Ror1 UTSW 4 100441059 missense probably benign 0.22
R7502:Ror1 UTSW 4 100333630 missense probably benign 0.03
R7531:Ror1 UTSW 4 100441191 missense probably damaging 1.00
R7661:Ror1 UTSW 4 100441490 missense probably damaging 1.00
R7822:Ror1 UTSW 4 100441367 missense probably damaging 1.00
R7831:Ror1 UTSW 4 100441098 missense probably benign 0.01
R8366:Ror1 UTSW 4 100409998 missense possibly damaging 0.91
R8539:Ror1 UTSW 4 100441887 missense possibly damaging 0.71
R8757:Ror1 UTSW 4 100440883 missense probably benign 0.01
R8862:Ror1 UTSW 4 100334518 critical splice donor site probably null
R9382:Ror1 UTSW 4 100334512 missense probably benign 0.00
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Z1177:Ror1 UTSW 4 100302919 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTGACCAACAGATGTTTTAAGGG -3'
(R):5'- TCTGTCAGGAAAGAAGCCCAG -3'

Sequencing Primer
(F):5'- CCAACAGATGTTTTAAGGGATGTTTG -3'
(R):5'- GAAGCCCAGAAAAACTCCTGG -3'
Posted On 2021-08-02