Incidental Mutation 'R8913:Csmd2'
ID678754
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R8913 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 128523558 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 2770 (P2770T)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,264,813 Y2102H probably damaging Het
Adam30 A T 3: 98,161,264 I10F possibly damaging Het
Afap1l1 C T 18: 61,756,839 probably null Het
Asz1 T C 6: 18,054,571 D411G probably benign Het
Atp8b2 A G 3: 89,945,523 L144P Het
Atxn7l3 G T 11: 102,294,961 N13K probably damaging Het
Cap1 C A 4: 122,867,652 probably null Het
Cd244 T A 1: 171,574,206 Y167N probably damaging Het
Cd244 A T 1: 171,574,207 Y167F probably damaging Het
Cd302 A G 2: 60,257,897 F92S probably damaging Het
Cep128 C T 12: 91,364,447 probably null Het
Cyp4f40 G T 17: 32,667,836 D122Y probably benign Het
Dnah14 A G 1: 181,725,498 E2583G probably benign Het
Dync1h1 T C 12: 110,658,168 V3714A probably benign Het
Fam114a1 G T 5: 65,028,478 A381S possibly damaging Het
Fam208a A T 14: 27,466,188 N864Y probably damaging Het
Fzd8 A G 18: 9,213,869 Y317C probably damaging Het
Igfn1 T C 1: 135,963,841 K2312R possibly damaging Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Klhl23 G A 2: 69,833,890 E528K probably damaging Het
Lama4 T C 10: 39,106,043 V1756A probably benign Het
Lcn2 C A 2: 32,387,146 V53F possibly damaging Het
Lrp4 T C 2: 91,501,440 S1633P probably benign Het
Map3k19 A G 1: 127,822,626 V996A probably benign Het
Mettl9 T G 7: 121,076,316 F313C probably damaging Het
Mios T A 6: 8,215,924 H373Q probably benign Het
Myo1a T C 10: 127,705,841 V83A probably benign Het
Naxe T C 3: 88,058,358 T45A probably benign Het
Nckap1 A G 2: 80,571,220 V40A possibly damaging Het
Nmt1 G T 11: 103,057,445 R265L probably damaging Het
Nwd2 C A 5: 63,806,097 A1008D possibly damaging Het
Obsl1 C T 1: 75,491,248 A1334T probably benign Het
Olfr1209 A G 2: 88,909,647 F249L probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1361 A G 13: 21,659,104 F73S probably damaging Het
Olfr517 A T 7: 108,868,602 V184E probably damaging Het
Olfr519 T C 7: 108,893,529 R298G probably damaging Het
Oplah T C 15: 76,297,480 M1114V Het
Pdlim5 A T 3: 142,244,905 F582L probably damaging Het
Plcb2 A G 2: 118,713,884 F671L probably damaging Het
Ppfibp1 T A 6: 147,022,449 V725E probably damaging Het
Psmd11 C T 11: 80,471,512 T396I probably damaging Het
Ptn C T 6: 36,741,341 D130N probably benign Het
Rasgrf2 T C 13: 92,022,526 D473G probably benign Het
Robo1 A C 16: 72,904,734 I163L probably damaging Het
Ror1 A C 4: 100,407,830 D167A possibly damaging Het
Rps6ka5 T C 12: 100,554,336 D709G Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Runx2 T C 17: 44,608,282 T472A probably benign Het
Scn11a T C 9: 119,794,028 T582A probably damaging Het
Serpina3m C T 12: 104,389,218 A48V probably benign Het
Slc9a3r2 G A 17: 24,644,865 S12L probably benign Het
Smim8 T A 4: 34,769,056 D76V possibly damaging Het
Sqor A G 2: 122,799,886 K260R probably benign Het
Syde2 A T 3: 146,002,393 I963F probably damaging Het
Tm7sf3 A T 6: 146,626,123 Y68* probably null Het
Tmtc2 T A 10: 105,323,026 I569F probably damaging Het
Upf3a G A 8: 13,795,728 V276M possibly damaging Het
Vmn1r174 G A 7: 23,753,950 V14M possibly damaging Het
Vmn2r104 A G 17: 20,029,706 S768P probably damaging Het
Vmn2r60 A T 7: 42,136,354 T194S probably benign Het
Zfhx2 A G 14: 55,072,086 M852T probably benign Het
Zfp207 T A 11: 80,385,918 D19E probably damaging Het
Zfp318 G A 17: 46,411,773 M1567I probably benign Het
Zfp407 T A 18: 84,560,528 E820V probably damaging Het
Zfp512b A T 2: 181,585,489 C46S Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 splice site probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 splice site probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
R8504:Csmd2 UTSW 4 128546690 missense
R8511:Csmd2 UTSW 4 128368899 missense
R8517:Csmd2 UTSW 4 128552686 missense
R8704:Csmd2 UTSW 4 128197354 missense
R8722:Csmd2 UTSW 4 128551950 unclassified probably benign
R8729:Csmd2 UTSW 4 128462845 missense
R8801:Csmd2 UTSW 4 128563402 missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128546684 missense
R8839:Csmd2 UTSW 4 128442888 missense
R8867:Csmd2 UTSW 4 128557676 missense
R8974:Csmd2 UTSW 4 128552587 missense
R9001:Csmd2 UTSW 4 128414286 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- ATCAAAGCTGGACACTGTGGG -3'
(R):5'- CTGTGCCTGCGTGTAATACAATTC -3'

Sequencing Primer
(F):5'- GACTCCAGAGCCCATTGTC -3'
(R):5'- AAAACCTGTAGTTAATGATGGCACAG -3'
Posted On2021-08-02