Incidental Mutation 'R8913:Scn11a'
ID 678769
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R8913 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 119753759-119825456 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119794028 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 582 (T582A)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: T582A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: T582A

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: T582A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,264,813 Y2102H probably damaging Het
Adam30 A T 3: 98,161,264 I10F possibly damaging Het
Afap1l1 C T 18: 61,756,839 probably null Het
Asz1 T C 6: 18,054,571 D411G probably benign Het
Atp8b2 A G 3: 89,945,523 L144P Het
Atxn7l3 G T 11: 102,294,961 N13K probably damaging Het
Cap1 C A 4: 122,867,652 probably null Het
Cd244 T A 1: 171,574,206 Y167N probably damaging Het
Cd244 A T 1: 171,574,207 Y167F probably damaging Het
Cd302 A G 2: 60,257,897 F92S probably damaging Het
Cep128 C T 12: 91,364,447 probably null Het
Csmd2 C A 4: 128,523,558 P2770T Het
Cyp4f40 G T 17: 32,667,836 D122Y probably benign Het
Dnah14 A G 1: 181,725,498 E2583G probably benign Het
Dync1h1 T C 12: 110,658,168 V3714A probably benign Het
Fam114a1 G T 5: 65,028,478 A381S possibly damaging Het
Fam208a A T 14: 27,466,188 N864Y probably damaging Het
Fzd8 A G 18: 9,213,869 Y317C probably damaging Het
Igfn1 T C 1: 135,963,841 K2312R possibly damaging Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Klhl23 G A 2: 69,833,890 E528K probably damaging Het
Lama4 T C 10: 39,106,043 V1756A probably benign Het
Lcn2 C A 2: 32,387,146 V53F possibly damaging Het
Lrp4 T C 2: 91,501,440 S1633P probably benign Het
Map3k19 A G 1: 127,822,626 V996A probably benign Het
Mettl9 T G 7: 121,076,316 F313C probably damaging Het
Mios T A 6: 8,215,924 H373Q probably benign Het
Mroh2b A G 15: 4,917,528 probably benign Het
Myo1a T C 10: 127,705,841 V83A probably benign Het
Naxe T C 3: 88,058,358 T45A probably benign Het
Nckap1 A G 2: 80,571,220 V40A possibly damaging Het
Nmt1 G T 11: 103,057,445 R265L probably damaging Het
Nwd2 C A 5: 63,806,097 A1008D possibly damaging Het
Obsl1 C T 1: 75,491,248 A1334T probably benign Het
Olfr1209 A G 2: 88,909,647 F249L probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr1361 A G 13: 21,659,104 F73S probably damaging Het
Olfr517 A T 7: 108,868,602 V184E probably damaging Het
Olfr519 T C 7: 108,893,529 R298G probably damaging Het
Oplah T C 15: 76,297,480 M1114V Het
Pdlim5 A T 3: 142,244,905 F582L probably damaging Het
Plcb2 A G 2: 118,713,884 F671L probably damaging Het
Ppfibp1 T A 6: 147,022,449 V725E probably damaging Het
Psmd11 C T 11: 80,471,512 T396I probably damaging Het
Ptn C T 6: 36,741,341 D130N probably benign Het
Rasgrf2 T C 13: 92,022,526 D473G probably benign Het
Robo1 A C 16: 72,904,734 I163L probably damaging Het
Ror1 A C 4: 100,407,830 D167A possibly damaging Het
Rps6ka5 T C 12: 100,554,336 D709G Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Runx2 T C 17: 44,608,282 T472A probably benign Het
Serpina3m C T 12: 104,389,218 A48V probably benign Het
Slc9a3r2 G A 17: 24,644,865 S12L probably benign Het
Smim8 T A 4: 34,769,056 D76V possibly damaging Het
Sqor A G 2: 122,799,886 K260R probably benign Het
Syde2 A T 3: 146,002,393 I963F probably damaging Het
Tenm4 G A 7: 96,702,745 probably benign Het
Tm7sf3 A T 6: 146,626,123 Y68* probably null Het
Tmtc2 T A 10: 105,323,026 I569F probably damaging Het
Upf3a G A 8: 13,795,728 V276M possibly damaging Het
Vmn1r174 G A 7: 23,753,950 V14M possibly damaging Het
Vmn2r104 A G 17: 20,029,706 S768P probably damaging Het
Vmn2r60 A T 7: 42,136,354 T194S probably benign Het
Zfhx2 A G 14: 55,072,086 M852T probably benign Het
Zfp207 T A 11: 80,385,918 D19E probably damaging Het
Zfp318 G A 17: 46,411,773 M1567I probably benign Het
Zfp407 T A 18: 84,560,528 E820V probably damaging Het
Zfp512b A T 2: 181,585,489 C46S Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
R8511:Scn11a UTSW 9 119789915 missense probably damaging 0.99
R8819:Scn11a UTSW 9 119816520 missense probably benign 0.19
R8820:Scn11a UTSW 9 119816520 missense probably benign 0.19
R8837:Scn11a UTSW 9 119792344 missense probably damaging 1.00
R8915:Scn11a UTSW 9 119774297 nonsense probably null
R8975:Scn11a UTSW 9 119758499 missense probably damaging 1.00
R9156:Scn11a UTSW 9 119759923 missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119781947 missense probably damaging 0.98
R9355:Scn11a UTSW 9 119755094 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGTGACCTGTGCAGAACTC -3'
(R):5'- TGACTCAGAGCAAACACCTG -3'

Sequencing Primer
(F):5'- AAACCAAGGTTTCAGTTTGGG -3'
(R):5'- GAGCAAACACCTGATCATTCTTC -3'
Posted On 2021-08-02