Incidental Mutation 'R8914:Pparg'
ID 678812
Institutional Source Beutler Lab
Gene Symbol Pparg
Ensembl Gene ENSMUSG00000000440
Gene Name peroxisome proliferator activated receptor gamma
Synonyms Ppar-gamma2, PPAR-gamma, Nr1c3, PPARgamma, PPARgamma2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8914 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 115360951-115490399 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115463172 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 236 (S236T)
Ref Sequence ENSEMBL: ENSMUSP00000000450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000450] [ENSMUST00000171644] [ENSMUST00000203732] [ENSMUST00000205213]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000000450
AA Change: S236T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000000450
Gene: ENSMUSG00000000440
AA Change: S236T

DomainStartEndE-ValueType
Pfam:PPARgamma_N 31 108 1.1e-35 PFAM
ZnF_C4 136 206 2.61e-34 SMART
HOLI 315 474 9.89e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171644
AA Change: S206T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131962
Gene: ENSMUSG00000000440
AA Change: S206T

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 3.1e-36 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203732
AA Change: S206T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145525
Gene: ENSMUSG00000000440
AA Change: S206T

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 2e-35 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205213
AA Change: S206T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000144975
Gene: ENSMUSG00000000440
AA Change: S206T

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 7.1e-33 PFAM
ZnF_C4 106 176 1.1e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a nuclear receptor protein belonging to the peroxisome proliferator-activated receptor (Ppar) family. The encoded protein is a ligand-activated transcription factor that is involved in the regulation of adipocyte differentiation and glucose homeostasis. The encoded protein forms a heterodimer with retinoid X receptors and binds to DNA motifs termed "peroxisome proliferator response elements" to either activate or inhibit gene expression. Mice lacking the encoded protein die at an embryonic stage due to severe defects in placental vascularization. When the embryos lacking this gene are supplemented with healthy placentas, the mutants survive to term, but succumb to lipodystrophy and multiple hemorrhages. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lethality due to placental defects. Heterozygotes show greater B cell proliferation, enhanced leptin secretion, and resistance to diet-induced adipocyte hypertrophy and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik C T 7: 107,624,715 E51K unknown Het
Akr1c20 T C 13: 4,511,216 D146G probably benign Het
Anapc4 T A 5: 52,843,501 C205* probably null Het
Ap3s2 A G 7: 79,915,163 I86T probably benign Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atp9a C T 2: 168,637,500 probably null Het
Bcl11b C A 12: 107,916,904 R384L probably damaging Het
Brca2 T A 5: 150,541,743 D1657E probably damaging Het
Cabyr C A 18: 12,751,020 T188N probably damaging Het
Capn5 C A 7: 98,135,790 W159L probably damaging Het
Ccnl1 A T 3: 65,946,659 S514T unknown Het
Cdk14 G T 5: 5,036,515 H286Q possibly damaging Het
Cpsf3 T A 12: 21,295,111 H141Q probably damaging Het
Ddx24 A G 12: 103,424,406 S109P possibly damaging Het
Dnmt3a A T 12: 3,866,192 R126* probably null Het
Dpys C A 15: 39,857,223 R47L probably benign Het
Dync1li2 A G 8: 104,425,458 V361A probably benign Het
Epha7 T G 4: 28,963,892 D962E probably damaging Het
Erh G T 12: 80,637,508 A65E probably benign Het
Fyb2 T C 4: 105,000,503 S626P probably benign Het
Gm6583 A T 5: 112,355,221 Y206N probably damaging Het
Gtpbp1 T A 15: 79,716,192 V442D probably damaging Het
Hecw1 T A 13: 14,247,603 I973F probably damaging Het
Igkv1-99 A C 6: 68,542,356 K99T Het
Igkv6-14 C T 6: 70,435,196 V35I probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Klk1b9 C T 7: 43,979,501 T143I possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Mettl15 A C 2: 109,137,280 probably benign Het
Mki67 A G 7: 135,697,866 V1813A Het
Mrps30 A G 13: 118,387,219 Y6H possibly damaging Het
Mthfd1 T A 12: 76,282,936 I176K probably benign Het
Nckap5l C T 15: 99,425,880 G914D probably damaging Het
Nemf C A 12: 69,316,315 E930* probably null Het
Nuggc G A 14: 65,641,905 V705I probably benign Het
Olfr1290 C A 2: 111,489,659 L166F probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr493 A G 7: 108,346,552 V143A probably benign Het
Olfr519 T C 7: 108,893,529 R298G probably damaging Het
Olfr606 T A 7: 103,451,883 L182Q probably damaging Het
Olfr764-ps1 C A 10: 129,035,503 M2I probably benign Het
Olfr996 A G 2: 85,579,712 T158A possibly damaging Het
Omd A T 13: 49,592,242 K376M probably damaging Het
Pi15 A G 1: 17,621,738 Y217C probably damaging Het
Pou5f1 T C 17: 35,510,474 S328P probably benign Het
Prss23 T C 7: 89,510,646 T72A probably benign Het
Ptprb C A 10: 116,322,662 S546* probably null Het
Ranbp9 A G 13: 43,425,084 I171T probably benign Het
Rap1gap2 A T 11: 74,435,761 L160* probably null Het
Rfxap T C 3: 54,807,621 T19A probably benign Het
Sctr T A 1: 120,031,656 F95I probably benign Het
Sf3b3 T A 8: 110,813,807 Q994L probably benign Het
Slfn9 A T 11: 82,981,306 I868N probably damaging Het
Top3a A T 11: 60,740,579 C986S probably damaging Het
Trak1 T A 9: 121,443,781 L245Q unknown Het
Trim27 A G 13: 21,180,823 D110G possibly damaging Het
Ubxn2a T C 12: 4,880,754 D202G probably benign Het
Uhrf1bp1 T G 17: 27,886,913 D804E possibly damaging Het
Urb1 T C 16: 90,810,234 K36R probably damaging Het
Usp34 A G 11: 23,343,604 T252A Het
Vmn1r73 C A 7: 11,756,401 H49N probably damaging Het
Vmn2r117 C T 17: 23,460,169 V694I probably benign Het
Vmn2r26 T C 6: 124,062,024 F853L probably benign Het
Vmn2r55 A T 7: 12,671,097 H126Q probably benign Het
Other mutations in Pparg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Pparg APN 6 115439861 missense probably damaging 0.99
IGL00938:Pparg APN 6 115463139 missense probably benign 0.09
IGL01303:Pparg APN 6 115472954 missense possibly damaging 0.89
IGL01454:Pparg APN 6 115439939 missense probably damaging 1.00
IGL01552:Pparg APN 6 115490122 missense probably benign 0.00
IGL02998:Pparg APN 6 115463088 missense probably benign 0.01
IGL03167:Pparg APN 6 115473227 missense probably damaging 1.00
IGL03179:Pparg APN 6 115439872 missense probably damaging 1.00
Energy UTSW 6 115451044 missense probably damaging 1.00
R1083:Pparg UTSW 6 115490146 missense probably damaging 0.99
R1569:Pparg UTSW 6 115439999 missense probably benign 0.14
R1620:Pparg UTSW 6 115473281 missense probably benign 0.01
R1850:Pparg UTSW 6 115450980 missense probably damaging 1.00
R2339:Pparg UTSW 6 115451044 missense probably damaging 1.00
R4429:Pparg UTSW 6 115440023 missense probably benign 0.09
R4941:Pparg UTSW 6 115490110 missense probably damaging 1.00
R4946:Pparg UTSW 6 115451028 missense probably damaging 1.00
R5110:Pparg UTSW 6 115473003 missense probably damaging 1.00
R5523:Pparg UTSW 6 115490071 missense probably damaging 1.00
R6900:Pparg UTSW 6 115472988 missense possibly damaging 0.87
R6994:Pparg UTSW 6 115451050 missense probably benign 0.36
R7177:Pparg UTSW 6 115441620 missense probably benign 0.40
R7755:Pparg UTSW 6 115463106 missense probably damaging 1.00
R8103:Pparg UTSW 6 115473141 missense possibly damaging 0.91
R8496:Pparg UTSW 6 115463151 missense probably benign 0.00
R8953:Pparg UTSW 6 115441546 missense possibly damaging 0.86
X0064:Pparg UTSW 6 115439914 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTGTTTGCTAGCGGATCC -3'
(R):5'- TGTTTTGGACCTAGCCTGCC -3'

Sequencing Primer
(F):5'- CCTAACAGGATCGTATGTTGCC -3'
(R):5'- CTAGATTTTAACAGCCTGCAGC -3'
Posted On 2021-08-02