Incidental Mutation 'R8914:Vmn2r26'
ID 678813
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R8914 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124062024 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 853 (F853L)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: F853L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: F853L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik C T 7: 107,624,715 E51K unknown Het
Akr1c20 T C 13: 4,511,216 D146G probably benign Het
Anapc4 T A 5: 52,843,501 C205* probably null Het
Ap3s2 A G 7: 79,915,163 I86T probably benign Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atp9a C T 2: 168,637,500 probably null Het
Bcl11b C A 12: 107,916,904 R384L probably damaging Het
Brca2 T A 5: 150,541,743 D1657E probably damaging Het
Cabyr C A 18: 12,751,020 T188N probably damaging Het
Capn5 C A 7: 98,135,790 W159L probably damaging Het
Ccnl1 A T 3: 65,946,659 S514T unknown Het
Cdk14 G T 5: 5,036,515 H286Q possibly damaging Het
Cpsf3 T A 12: 21,295,111 H141Q probably damaging Het
Ddx24 A G 12: 103,424,406 S109P possibly damaging Het
Dnmt3a A T 12: 3,866,192 R126* probably null Het
Dpys C A 15: 39,857,223 R47L probably benign Het
Dync1li2 A G 8: 104,425,458 V361A probably benign Het
Epha7 T G 4: 28,963,892 D962E probably damaging Het
Erh G T 12: 80,637,508 A65E probably benign Het
Fyb2 T C 4: 105,000,503 S626P probably benign Het
Gm6583 A T 5: 112,355,221 Y206N probably damaging Het
Gtpbp1 T A 15: 79,716,192 V442D probably damaging Het
Hecw1 T A 13: 14,247,603 I973F probably damaging Het
Igkv1-99 A C 6: 68,542,356 K99T Het
Igkv6-14 C T 6: 70,435,196 V35I probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Klk1b9 C T 7: 43,979,501 T143I possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Mettl15 A C 2: 109,137,280 probably benign Het
Mki67 A G 7: 135,697,866 V1813A Het
Mrps30 A G 13: 118,387,219 Y6H possibly damaging Het
Mthfd1 T A 12: 76,282,936 I176K probably benign Het
Nckap5l C T 15: 99,425,880 G914D probably damaging Het
Nemf C A 12: 69,316,315 E930* probably null Het
Nuggc G A 14: 65,641,905 V705I probably benign Het
Olfr1290 C A 2: 111,489,659 L166F probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr493 A G 7: 108,346,552 V143A probably benign Het
Olfr519 T C 7: 108,893,529 R298G probably damaging Het
Olfr606 T A 7: 103,451,883 L182Q probably damaging Het
Olfr764-ps1 C A 10: 129,035,503 M2I probably benign Het
Olfr996 A G 2: 85,579,712 T158A possibly damaging Het
Omd A T 13: 49,592,242 K376M probably damaging Het
Pi15 A G 1: 17,621,738 Y217C probably damaging Het
Pou5f1 T C 17: 35,510,474 S328P probably benign Het
Pparg T A 6: 115,463,172 S236T probably benign Het
Prss23 T C 7: 89,510,646 T72A probably benign Het
Ptprb C A 10: 116,322,662 S546* probably null Het
Ranbp9 A G 13: 43,425,084 I171T probably benign Het
Rap1gap2 A T 11: 74,435,761 L160* probably null Het
Rfxap T C 3: 54,807,621 T19A probably benign Het
Sctr T A 1: 120,031,656 F95I probably benign Het
Sf3b3 T A 8: 110,813,807 Q994L probably benign Het
Slfn9 A T 11: 82,981,306 I868N probably damaging Het
Top3a A T 11: 60,740,579 C986S probably damaging Het
Trak1 T A 9: 121,443,781 L245Q unknown Het
Trim27 A G 13: 21,180,823 D110G possibly damaging Het
Ubxn2a T C 12: 4,880,754 D202G probably benign Het
Uhrf1bp1 T G 17: 27,886,913 D804E possibly damaging Het
Urb1 T C 16: 90,810,234 K36R probably damaging Het
Usp34 A G 11: 23,343,604 T252A Het
Vmn1r73 C A 7: 11,756,401 H49N probably damaging Het
Vmn2r117 C T 17: 23,460,169 V694I probably benign Het
Vmn2r55 A T 7: 12,671,097 H126Q probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGAAGGCTACCTGACAGCTTC -3'
(R):5'- TCACTGTGTCTAGTTGGCTCTAAG -3'

Sequencing Primer
(F):5'- GCTACCTGACAGCTTCAATGAGG -3'
(R):5'- TCTAGTTGGCTCTAAGGATAACAGG -3'
Posted On 2021-08-02