Incidental Mutation 'R8914:Nuggc'
ID 678849
Institutional Source Beutler Lab
Gene Symbol Nuggc
Ensembl Gene ENSMUSG00000061356
Gene Name nuclear GTPase, germinal center associated
Synonyms Gm600, SLIP-GC, LOC239151
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R8914 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 65598546-65648531 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65641905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 705 (V705I)
Ref Sequence ENSEMBL: ENSMUSP00000078434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]
AlphaFold D3YWJ0
Predicted Effect probably benign
Transcript: ENSMUST00000079469
AA Change: V705I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356
AA Change: V705I

DomainStartEndE-ValueType
Pfam:Dynamin_N 119 372 2.2e-15 PFAM
low complexity region 406 421 N/A INTRINSIC
Blast:AAA 434 739 4e-14 BLAST
coiled coil region 758 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150897
AA Change: V689I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356
AA Change: V689I

DomainStartEndE-ValueType
Pfam:Dynamin_N 103 356 6.1e-16 PFAM
low complexity region 390 405 N/A INTRINSIC
Blast:AAA 418 723 4e-14 BLAST
coiled coil region 742 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik C T 7: 107,624,715 E51K unknown Het
Akr1c20 T C 13: 4,511,216 D146G probably benign Het
Anapc4 T A 5: 52,843,501 C205* probably null Het
Ap3s2 A G 7: 79,915,163 I86T probably benign Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atp9a C T 2: 168,637,500 probably null Het
Bcl11b C A 12: 107,916,904 R384L probably damaging Het
Brca2 T A 5: 150,541,743 D1657E probably damaging Het
Cabyr C A 18: 12,751,020 T188N probably damaging Het
Capn5 C A 7: 98,135,790 W159L probably damaging Het
Ccnl1 A T 3: 65,946,659 S514T unknown Het
Cdk14 G T 5: 5,036,515 H286Q possibly damaging Het
Cpsf3 T A 12: 21,295,111 H141Q probably damaging Het
Ddx24 A G 12: 103,424,406 S109P possibly damaging Het
Dnmt3a A T 12: 3,866,192 R126* probably null Het
Dpys C A 15: 39,857,223 R47L probably benign Het
Dync1li2 A G 8: 104,425,458 V361A probably benign Het
Epha7 T G 4: 28,963,892 D962E probably damaging Het
Erh G T 12: 80,637,508 A65E probably benign Het
Fyb2 T C 4: 105,000,503 S626P probably benign Het
Gm6583 A T 5: 112,355,221 Y206N probably damaging Het
Gtpbp1 T A 15: 79,716,192 V442D probably damaging Het
Hecw1 T A 13: 14,247,603 I973F probably damaging Het
Igkv1-99 A C 6: 68,542,356 K99T Het
Igkv6-14 C T 6: 70,435,196 V35I probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Klk1b9 C T 7: 43,979,501 T143I possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Mettl15 A C 2: 109,137,280 probably benign Het
Mki67 A G 7: 135,697,866 V1813A Het
Mrps30 A G 13: 118,387,219 Y6H possibly damaging Het
Mthfd1 T A 12: 76,282,936 I176K probably benign Het
Nckap5l C T 15: 99,425,880 G914D probably damaging Het
Nemf C A 12: 69,316,315 E930* probably null Het
Olfr1290 C A 2: 111,489,659 L166F probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr493 A G 7: 108,346,552 V143A probably benign Het
Olfr519 T C 7: 108,893,529 R298G probably damaging Het
Olfr606 T A 7: 103,451,883 L182Q probably damaging Het
Olfr764-ps1 C A 10: 129,035,503 M2I probably benign Het
Olfr996 A G 2: 85,579,712 T158A possibly damaging Het
Omd A T 13: 49,592,242 K376M probably damaging Het
Pi15 A G 1: 17,621,738 Y217C probably damaging Het
Pou5f1 T C 17: 35,510,474 S328P probably benign Het
Pparg T A 6: 115,463,172 S236T probably benign Het
Prss23 T C 7: 89,510,646 T72A probably benign Het
Ptprb C A 10: 116,322,662 S546* probably null Het
Ranbp9 A G 13: 43,425,084 I171T probably benign Het
Rap1gap2 A T 11: 74,435,761 L160* probably null Het
Rfxap T C 3: 54,807,621 T19A probably benign Het
Sctr T A 1: 120,031,656 F95I probably benign Het
Sf3b3 T A 8: 110,813,807 Q994L probably benign Het
Slfn9 A T 11: 82,981,306 I868N probably damaging Het
Top3a A T 11: 60,740,579 C986S probably damaging Het
Trak1 T A 9: 121,443,781 L245Q unknown Het
Trim27 A G 13: 21,180,823 D110G possibly damaging Het
Ubxn2a T C 12: 4,880,754 D202G probably benign Het
Uhrf1bp1 T G 17: 27,886,913 D804E possibly damaging Het
Urb1 T C 16: 90,810,234 K36R probably damaging Het
Usp34 A G 11: 23,343,604 T252A Het
Vmn1r73 C A 7: 11,756,401 H49N probably damaging Het
Vmn2r117 C T 17: 23,460,169 V694I probably benign Het
Vmn2r26 T C 6: 124,062,024 F853L probably benign Het
Vmn2r55 A T 7: 12,671,097 H126Q probably benign Het
Other mutations in Nuggc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Nuggc APN 14 65623207 missense probably damaging 1.00
IGL01403:Nuggc APN 14 65623186 missense probably benign 0.01
IGL01413:Nuggc APN 14 65638581 missense probably benign 0.23
IGL02588:Nuggc APN 14 65617777 splice site probably benign
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0395:Nuggc UTSW 14 65613472 nonsense probably null
R0827:Nuggc UTSW 14 65608891 missense probably damaging 1.00
R1496:Nuggc UTSW 14 65624133 missense probably damaging 0.96
R1861:Nuggc UTSW 14 65642001 splice site probably benign
R1986:Nuggc UTSW 14 65641921 missense probably damaging 0.98
R1995:Nuggc UTSW 14 65611174 missense probably benign 0.02
R2283:Nuggc UTSW 14 65638612 missense possibly damaging 0.89
R2317:Nuggc UTSW 14 65624142 missense possibly damaging 0.81
R3799:Nuggc UTSW 14 65619638 missense probably benign 0.00
R3980:Nuggc UTSW 14 65619093 critical splice donor site probably null
R4303:Nuggc UTSW 14 65611172 missense possibly damaging 0.77
R4431:Nuggc UTSW 14 65611210 missense probably benign 0.19
R4734:Nuggc UTSW 14 65623230 missense probably damaging 1.00
R5095:Nuggc UTSW 14 65635090 nonsense probably null
R5108:Nuggc UTSW 14 65638680 missense probably damaging 0.99
R5360:Nuggc UTSW 14 65638626 missense probably damaging 1.00
R5547:Nuggc UTSW 14 65641881 missense possibly damaging 0.87
R5636:Nuggc UTSW 14 65648188 nonsense probably null
R6494:Nuggc UTSW 14 65648222 missense probably damaging 1.00
R6922:Nuggc UTSW 14 65617643 missense probably damaging 1.00
R6971:Nuggc UTSW 14 65608856 missense probably benign 0.04
R7124:Nuggc UTSW 14 65608802 missense probably damaging 1.00
R7273:Nuggc UTSW 14 65619608 missense probably damaging 0.99
R7282:Nuggc UTSW 14 65617623 missense probably damaging 1.00
R7578:Nuggc UTSW 14 65648174 missense probably damaging 1.00
R7670:Nuggc UTSW 14 65613526 missense probably damaging 1.00
R7780:Nuggc UTSW 14 65645041 missense probably damaging 1.00
R7871:Nuggc UTSW 14 65623251 missense probably benign 0.01
R8250:Nuggc UTSW 14 65641869 missense probably benign 0.10
R8329:Nuggc UTSW 14 65641282 missense probably benign 0.01
R8334:Nuggc UTSW 14 65645029 missense probably benign 0.04
R8463:Nuggc UTSW 14 65613562 missense probably damaging 1.00
R8503:Nuggc UTSW 14 65641348 critical splice donor site probably null
R8737:Nuggc UTSW 14 65645086 missense probably benign 0.00
R8861:Nuggc UTSW 14 65610035 critical splice donor site probably null
R9573:Nuggc UTSW 14 65611154 missense probably benign 0.37
R9666:Nuggc UTSW 14 65619596 missense possibly damaging 0.86
R9792:Nuggc UTSW 14 65609896 missense probably damaging 1.00
R9793:Nuggc UTSW 14 65609896 missense probably damaging 1.00
R9795:Nuggc UTSW 14 65609896 missense probably damaging 1.00
RF019:Nuggc UTSW 14 65648264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTACATGTGCGTTTCTGC -3'
(R):5'- CCATGTGGCCATATGCTAGG -3'

Sequencing Primer
(F):5'- GCTTGCTTGCTTGCCCGG -3'
(R):5'- GATGGCATCCAGCTCTACTG -3'
Posted On 2021-08-02