Incidental Mutation 'R8915:Sh3bp4'
ID 678863
Institutional Source Beutler Lab
Gene Symbol Sh3bp4
Ensembl Gene ENSMUSG00000036206
Gene Name SH3-domain binding protein 4
Synonyms BOG25
MMRRC Submission 068703-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8915 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 88998137-89082790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 89080064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 873 (A873D)
Ref Sequence ENSEMBL: ENSMUSP00000067581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066279]
AlphaFold Q921I6
Predicted Effect probably damaging
Transcript: ENSMUST00000066279
AA Change: A873D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: A873D

DomainStartEndE-ValueType
SH3 58 113 5.04e-13 SMART
low complexity region 196 212 N/A INTRINSIC
Pfam:ZU5 318 411 1.8e-12 PFAM
Pfam:SH3_2 657 721 3.5e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp4 T A 7: 43,903,751 (GRCm39) H217L possibly damaging Het
Adgrv1 C T 13: 81,715,558 (GRCm39) V877I probably damaging Het
Aste1 G A 9: 105,273,880 (GRCm39) C40Y probably benign Het
Asxl3 T A 18: 22,657,763 (GRCm39) D1924E probably benign Het
Bmp4 T A 14: 46,621,902 (GRCm39) E214V probably damaging Het
Calhm5 T C 10: 33,968,415 (GRCm39) S213G probably benign Het
Carmil1 A G 13: 24,325,709 (GRCm39) L207P probably damaging Het
Cdh24 T C 14: 54,876,612 (GRCm39) D71G probably damaging Het
Cdhr2 G T 13: 54,874,184 (GRCm39) W752L probably benign Het
Clec1b T C 6: 129,382,212 (GRCm39) *230Q probably null Het
Ctbs T C 3: 146,169,724 (GRCm39) V327A probably benign Het
Cyp2c40 A T 19: 39,795,991 (GRCm39) I129N probably benign Het
Dnajc10 T A 2: 80,147,801 (GRCm39) L21H possibly damaging Het
Dysf A G 6: 84,156,736 (GRCm39) D1487G probably benign Het
Epb42 T C 2: 120,849,987 (GRCm39) Q674R possibly damaging Het
Foxb2 T C 19: 16,850,958 (GRCm39) Y16C unknown Het
Fto T C 8: 92,136,471 (GRCm39) probably null Het
Gcfc2 A G 6: 81,918,347 (GRCm39) K346E probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gpam A G 19: 55,077,312 (GRCm39) S160P probably benign Het
Has2 C T 15: 56,531,885 (GRCm39) V277I probably damaging Het
Herc1 T C 9: 66,318,456 (GRCm39) Y1243H probably damaging Het
Hhat C T 1: 192,277,203 (GRCm39) E419K probably benign Het
Hsd17b11 T C 5: 104,140,802 (GRCm39) probably null Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Lactbl1 G T 4: 136,360,243 (GRCm39) A141S probably benign Het
Ncoa5 T C 2: 164,854,927 (GRCm39) D65G possibly damaging Het
Nfkbie A G 17: 45,871,067 (GRCm39) I240V probably benign Het
Nim1k T A 13: 120,173,874 (GRCm39) D340V probably benign Het
Oas2 T C 5: 120,876,449 (GRCm39) K498R possibly damaging Het
Or52e2 C T 7: 102,804,411 (GRCm39) C181Y probably damaging Het
Pard6g T C 18: 80,160,957 (GRCm39) S357P probably damaging Het
Pigk G A 3: 152,472,098 (GRCm39) E384K probably benign Het
Ppp4r1 T C 17: 66,136,376 (GRCm39) V528A probably damaging Het
Rbm34 A G 8: 127,679,908 (GRCm39) probably benign Het
Rnd1 A G 15: 98,575,181 (GRCm39) V17A probably damaging Het
Ros1 C T 10: 51,977,805 (GRCm39) probably benign Het
Samd14 A C 11: 94,912,027 (GRCm39) D168A probably damaging Het
Scin T C 12: 40,123,432 (GRCm39) S484G probably damaging Het
Scn11a C T 9: 119,603,363 (GRCm39) W1101* probably null Het
Scrn3 T A 2: 73,148,636 (GRCm39) V69D probably damaging Het
Serpina3j A G 12: 104,281,309 (GRCm39) T161A probably benign Het
Tmem131 A T 1: 36,868,658 (GRCm39) I389N probably damaging Het
Tpp2 T C 1: 44,016,415 (GRCm39) L690P probably damaging Het
Trip13 T C 13: 74,081,085 (GRCm39) T94A probably benign Het
Vmn1r114 A T 7: 20,545,171 (GRCm39) L314* probably null Het
Vmn2r44 A G 7: 8,370,650 (GRCm39) Y799H probably damaging Het
Zfp574 T C 7: 24,780,769 (GRCm39) L597P probably damaging Het
Zfp944 A T 17: 22,558,507 (GRCm39) C247S probably benign Het
Other mutations in Sh3bp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sh3bp4 APN 1 89,071,682 (GRCm39) missense probably benign
IGL01344:Sh3bp4 APN 1 89,080,958 (GRCm39) missense probably benign
IGL02025:Sh3bp4 APN 1 89,073,008 (GRCm39) missense probably benign 0.40
IGL02035:Sh3bp4 APN 1 89,071,412 (GRCm39) missense probably benign 0.00
IGL02389:Sh3bp4 APN 1 89,072,870 (GRCm39) missense probably damaging 0.99
IGL02430:Sh3bp4 APN 1 89,080,885 (GRCm39) missense probably null 0.00
IGL02546:Sh3bp4 APN 1 89,071,266 (GRCm39) splice site probably benign
IGL03327:Sh3bp4 APN 1 89,071,885 (GRCm39) nonsense probably null
I0000:Sh3bp4 UTSW 1 89,065,518 (GRCm39) missense probably benign 0.01
PIT4366001:Sh3bp4 UTSW 1 89,073,156 (GRCm39) missense probably benign
R0128:Sh3bp4 UTSW 1 89,073,036 (GRCm39) missense possibly damaging 0.54
R0130:Sh3bp4 UTSW 1 89,073,036 (GRCm39) missense possibly damaging 0.54
R1370:Sh3bp4 UTSW 1 89,071,494 (GRCm39) missense probably benign 0.43
R1500:Sh3bp4 UTSW 1 89,073,210 (GRCm39) missense probably damaging 1.00
R2269:Sh3bp4 UTSW 1 89,073,314 (GRCm39) missense possibly damaging 0.62
R3407:Sh3bp4 UTSW 1 89,072,769 (GRCm39) missense possibly damaging 0.86
R3408:Sh3bp4 UTSW 1 89,072,769 (GRCm39) missense possibly damaging 0.86
R3615:Sh3bp4 UTSW 1 89,065,427 (GRCm39) missense probably damaging 0.99
R3616:Sh3bp4 UTSW 1 89,065,427 (GRCm39) missense probably damaging 0.99
R3721:Sh3bp4 UTSW 1 89,073,050 (GRCm39) missense possibly damaging 0.93
R3983:Sh3bp4 UTSW 1 89,073,591 (GRCm39) missense probably benign 0.00
R4631:Sh3bp4 UTSW 1 89,071,995 (GRCm39) missense probably damaging 1.00
R5024:Sh3bp4 UTSW 1 89,073,317 (GRCm39) missense probably damaging 1.00
R5040:Sh3bp4 UTSW 1 89,071,962 (GRCm39) missense probably damaging 1.00
R5249:Sh3bp4 UTSW 1 89,065,456 (GRCm39) missense probably damaging 1.00
R5306:Sh3bp4 UTSW 1 89,071,997 (GRCm39) missense probably damaging 0.99
R5319:Sh3bp4 UTSW 1 89,073,072 (GRCm39) missense probably benign
R5908:Sh3bp4 UTSW 1 89,073,605 (GRCm39) missense probably damaging 0.99
R6296:Sh3bp4 UTSW 1 89,073,211 (GRCm39) missense probably damaging 1.00
R6572:Sh3bp4 UTSW 1 89,072,643 (GRCm39) missense possibly damaging 0.78
R6660:Sh3bp4 UTSW 1 89,080,888 (GRCm39) missense possibly damaging 0.62
R6900:Sh3bp4 UTSW 1 89,073,489 (GRCm39) missense probably benign 0.00
R7319:Sh3bp4 UTSW 1 89,080,824 (GRCm39) splice site probably null
R7320:Sh3bp4 UTSW 1 89,073,216 (GRCm39) missense probably damaging 1.00
R7393:Sh3bp4 UTSW 1 89,072,170 (GRCm39) missense possibly damaging 0.79
R7516:Sh3bp4 UTSW 1 89,073,368 (GRCm39) missense probably damaging 1.00
R8402:Sh3bp4 UTSW 1 89,073,037 (GRCm39) missense probably benign 0.00
R8899:Sh3bp4 UTSW 1 89,073,297 (GRCm39) missense probably benign 0.45
R8953:Sh3bp4 UTSW 1 89,072,159 (GRCm39) missense probably damaging 0.97
R9137:Sh3bp4 UTSW 1 89,072,647 (GRCm39) nonsense probably null
R9718:Sh3bp4 UTSW 1 89,073,472 (GRCm39) missense probably damaging 0.99
RF016:Sh3bp4 UTSW 1 89,072,744 (GRCm39) missense probably benign
Z1176:Sh3bp4 UTSW 1 89,073,450 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CATCTACAGGTTGACCGTCC -3'
(R):5'- GGGTATACTTTGTATTGGGCAACC -3'

Sequencing Primer
(F):5'- AGGTTGACCGTCCCCTGAAG -3'
(R):5'- GGCAACCTCACTTCACCTCAG -3'
Posted On 2021-08-02