Incidental Mutation 'R8916:Myo3a'
ID 678916
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Name myosin IIIA
Synonyms 9030416P08Rik
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8916 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 22227503-22618252 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22567692 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1046 (F1046I)
Ref Sequence ENSEMBL: ENSMUSP00000046329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000138863]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044749
AA Change: F1046I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: F1046I

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138863
AA Change: F108I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116185
Gene: ENSMUSG00000025716
AA Change: F108I

DomainStartEndE-ValueType
Pfam:Myosin_head 1 110 1.7e-28 PFAM
IQ 123 145 2.88e1 SMART
IQ 150 172 9.48e-3 SMART
low complexity region 215 231 N/A INTRINSIC
low complexity region 421 431 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C A 4: 42,973,034 P789H probably damaging Het
2210010C04Rik T A 6: 41,033,169 H77L probably damaging Het
Adamts16 A G 13: 70,793,188 L360S probably damaging Het
AW554918 T C 18: 25,289,992 Y167H probably damaging Het
Cdh18 A T 15: 23,410,727 I433F probably damaging Het
Cenpj A T 14: 56,552,895 F566I probably damaging Het
Cntn4 T A 6: 106,675,954 Y795N probably damaging Het
Col4a4 C T 1: 82,523,946 G362E unknown Het
Crebrf A G 17: 26,739,609 T18A probably damaging Het
D130043K22Rik G A 13: 24,872,271 V529I probably benign Het
Dars2 T C 1: 161,053,982 T326A probably benign Het
Eif4e T C 3: 138,550,282 probably benign Het
Enpp2 T C 15: 54,870,326 M413V possibly damaging Het
Fam129b T A 2: 32,921,094 M372K possibly damaging Het
Fam71a A G 1: 191,163,660 I262T probably benign Het
Fbn1 T C 2: 125,403,229 D246G possibly damaging Het
Foxred2 A G 15: 77,953,314 S241P probably damaging Het
Fras1 T C 5: 96,752,915 F2998L probably damaging Het
Grb10 T C 11: 11,951,599 T192A probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Hinfp A T 9: 44,298,376 F234I probably damaging Het
Hmcn1 A T 1: 150,773,779 I652N probably damaging Het
Hrasls A G 16: 29,220,507 D113G possibly damaging Het
Kif24 T C 4: 41,394,963 K771E probably benign Het
Lhcgr A G 17: 88,753,742 probably null Het
Lnpk A T 2: 74,528,142 S358T probably benign Het
Lpcat2 A T 8: 92,869,688 M118L probably benign Het
Lypd1 T A 1: 125,873,383 T127S unknown Het
Mettl23 C T 11: 116,849,285 T194I probably damaging Het
Mga T C 2: 119,958,338 V2227A possibly damaging Het
Mus81 A T 19: 5,484,186 V368E probably damaging Het
Nfia G A 4: 98,000,430 V222I probably benign Het
Nop9 A G 14: 55,753,644 E586G probably benign Het
Nr2e1 G A 10: 42,567,868 A286V possibly damaging Het
Nup153 G A 13: 46,709,986 Q300* probably null Het
Pnp2 T C 14: 50,963,777 L202P probably damaging Het
Psen2 A G 1: 180,235,930 F183L probably benign Het
Rint1 G T 5: 23,787,828 probably benign Het
Rsf1 GGC GGCGGCGGCCGC 7: 97,579,933 probably benign Het
Ryr3 C A 2: 112,778,290 R2335L probably damaging Het
Scn1a T C 2: 66,277,783 D1544G probably damaging Het
Sec31b A C 19: 44,532,344 S175A Het
Sgcg A G 14: 61,236,892 S101P probably damaging Het
Shb A T 4: 45,489,154 S241T probably damaging Het
Slc47a2 A T 11: 61,302,292 L545Q probably damaging Het
Spef2 C A 15: 9,725,180 E164* probably null Het
Sphkap A T 1: 83,277,387 N880K possibly damaging Het
Taf2 A G 15: 55,036,535 V894A probably benign Het
Tgfa T G 6: 86,271,454 L146R probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tlr4 G A 4: 66,929,031 V132I probably benign Het
Tsen34 C T 7: 3,694,341 probably benign Het
Ttc13 T G 8: 124,683,237 K412T probably damaging Het
Unc45b A G 11: 82,913,212 I72V probably benign Het
Vmn1r195 A G 13: 22,278,969 Y203C probably damaging Het
Vmn2r65 T A 7: 84,946,457 T340S probably benign Het
Vmn2r88 T A 14: 51,411,136 C46S Het
Ythdf2 A T 4: 132,204,519 D443E probably damaging Het
Zeb2 T C 2: 44,996,784 R754G probably damaging Het
Zfp236 T A 18: 82,646,226 E478V probably damaging Het
Zfp287 A T 11: 62,714,310 Y590* probably null Het
Zfp9 A T 6: 118,465,262 C146* probably null Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
lose UTSW 2 22558320 nonsense probably null
snooze UTSW 2 22282634 missense probably damaging 0.99
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense possibly damaging 0.78
R7301:Myo3a UTSW 2 22544466 critical splice donor site probably null
R7318:Myo3a UTSW 2 22558320 nonsense probably null
R7447:Myo3a UTSW 2 22544426 missense probably benign 0.27
R7456:Myo3a UTSW 2 22407444 missense probably benign 0.08
R7528:Myo3a UTSW 2 22266114 nonsense probably null
R7731:Myo3a UTSW 2 22282589 missense probably damaging 1.00
R7768:Myo3a UTSW 2 22241143 missense probably damaging 0.99
R8054:Myo3a UTSW 2 22574317 missense probably benign 0.00
R8140:Myo3a UTSW 2 22407346 missense probably damaging 1.00
R8143:Myo3a UTSW 2 22282665 critical splice donor site probably null
R8346:Myo3a UTSW 2 22558422 critical splice donor site probably null
R8421:Myo3a UTSW 2 22362124 missense probably benign 0.07
R8495:Myo3a UTSW 2 22396273 missense probably damaging 0.96
R8551:Myo3a UTSW 2 22332466 missense probably benign 0.00
R8708:Myo3a UTSW 2 22291796 splice site probably benign
R8757:Myo3a UTSW 2 22558307 missense possibly damaging 0.49
R8759:Myo3a UTSW 2 22558307 missense possibly damaging 0.49
R8779:Myo3a UTSW 2 22245593 nonsense probably null
R8828:Myo3a UTSW 2 22241053 missense probably benign 0.01
R8910:Myo3a UTSW 2 22574268 missense probably benign 0.01
R8926:Myo3a UTSW 2 22396263 missense possibly damaging 0.95
R9028:Myo3a UTSW 2 22600087 missense possibly damaging 0.79
R9046:Myo3a UTSW 2 22558355 missense probably damaging 0.99
R9120:Myo3a UTSW 2 22544426 missense probably benign 0.27
R9153:Myo3a UTSW 2 22399933 missense probably benign 0.02
R9191:Myo3a UTSW 2 22579829 missense probably benign 0.24
R9258:Myo3a UTSW 2 22577533 missense possibly damaging 0.60
R9436:Myo3a UTSW 2 22407424 nonsense probably null
Z1177:Myo3a UTSW 2 22618140 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGAACCCCAGAGTTTGCCAG -3'
(R):5'- AGGTCTGTGCGTAAGACATAC -3'

Sequencing Primer
(F):5'- ACCTCACATGGATGTCTGACTAGG -3'
(R):5'- GACCCAGTTATGGTTTTTACATTGC -3'
Posted On 2021-08-02