Incidental Mutation 'R8916:Scn1a'
ID 678919
Institutional Source Beutler Lab
Gene Symbol Scn1a
Ensembl Gene ENSMUSG00000064329
Gene Name sodium channel, voltage-gated, type I, alpha
Synonyms Nav1.1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8916 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 66270778-66440840 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66277783 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1544 (D1544G)
Ref Sequence ENSEMBL: ENSMUSP00000107985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000156865]
AlphaFold A2APX8
Predicted Effect probably damaging
Transcript: ENSMUST00000077489
AA Change: D1533G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: D1533G

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094951
AA Change: D1516G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: D1516G

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.3e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 691 2e-62 PFAM
Pfam:Ion_trans 774 963 6.7e-47 PFAM
Pfam:Na_trans_assoc 978 1200 1.2e-74 PFAM
Pfam:Ion_trans 1226 1454 1e-56 PFAM
PDB:1BYY|A 1456 1508 4e-31 PDB
Pfam:Ion_trans 1547 1757 1.1e-51 PFAM
Pfam:PKD_channel 1606 1764 3.8e-7 PFAM
low complexity region 1809 1821 N/A INTRINSIC
IQ 1886 1908 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112366
AA Change: D1544G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: D1544G

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 127 434 2.8e-82 PFAM
Pfam:Na_trans_cytopl 502 718 2e-91 PFAM
Pfam:Ion_trans 767 1002 6.5e-57 PFAM
Pfam:Na_trans_assoc 1006 1213 1.2e-60 PFAM
Pfam:Ion_trans 1217 1493 3.3e-67 PFAM
Pfam:Ion_trans 1540 1797 6.3e-56 PFAM
Pfam:PKD_channel 1637 1791 1.1e-6 PFAM
low complexity region 1837 1849 N/A INTRINSIC
IQ 1914 1936 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112371
AA Change: D1533G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: D1533G

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156865
SMART Domains Protein: ENSMUSP00000144633
Gene: ENSMUSG00000064329

DomainStartEndE-ValueType
Pfam:Na_trans_assoc 1 182 2.2e-44 PFAM
Pfam:Ion_trans 186 462 1.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200839
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C A 4: 42,973,034 P789H probably damaging Het
2210010C04Rik T A 6: 41,033,169 H77L probably damaging Het
Adamts16 A G 13: 70,793,188 L360S probably damaging Het
AW554918 T C 18: 25,289,992 Y167H probably damaging Het
Cdh18 A T 15: 23,410,727 I433F probably damaging Het
Cenpj A T 14: 56,552,895 F566I probably damaging Het
Cntn4 T A 6: 106,675,954 Y795N probably damaging Het
Col4a4 C T 1: 82,523,946 G362E unknown Het
Crebrf A G 17: 26,739,609 T18A probably damaging Het
D130043K22Rik G A 13: 24,872,271 V529I probably benign Het
Dars2 T C 1: 161,053,982 T326A probably benign Het
Eif4e T C 3: 138,550,282 probably benign Het
Enpp2 T C 15: 54,870,326 M413V possibly damaging Het
Fam129b T A 2: 32,921,094 M372K possibly damaging Het
Fam71a A G 1: 191,163,660 I262T probably benign Het
Fbn1 T C 2: 125,403,229 D246G possibly damaging Het
Foxred2 A G 15: 77,953,314 S241P probably damaging Het
Fras1 T C 5: 96,752,915 F2998L probably damaging Het
Grb10 T C 11: 11,951,599 T192A probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Hinfp A T 9: 44,298,376 F234I probably damaging Het
Hmcn1 A T 1: 150,773,779 I652N probably damaging Het
Hrasls A G 16: 29,220,507 D113G possibly damaging Het
Kif24 T C 4: 41,394,963 K771E probably benign Het
Lhcgr A G 17: 88,753,742 probably null Het
Lnpk A T 2: 74,528,142 S358T probably benign Het
Lpcat2 A T 8: 92,869,688 M118L probably benign Het
Lypd1 T A 1: 125,873,383 T127S unknown Het
Mettl23 C T 11: 116,849,285 T194I probably damaging Het
Mga T C 2: 119,958,338 V2227A possibly damaging Het
Mus81 A T 19: 5,484,186 V368E probably damaging Het
Myo3a T A 2: 22,567,692 F1046I probably damaging Het
Nfia G A 4: 98,000,430 V222I probably benign Het
Nop9 A G 14: 55,753,644 E586G probably benign Het
Nr2e1 G A 10: 42,567,868 A286V possibly damaging Het
Nup153 G A 13: 46,709,986 Q300* probably null Het
Pnp2 T C 14: 50,963,777 L202P probably damaging Het
Psen2 A G 1: 180,235,930 F183L probably benign Het
Rint1 G T 5: 23,787,828 probably benign Het
Rsf1 GGC GGCGGCGGCCGC 7: 97,579,933 probably benign Het
Ryr3 C A 2: 112,778,290 R2335L probably damaging Het
Sec31b A C 19: 44,532,344 S175A Het
Sgcg A G 14: 61,236,892 S101P probably damaging Het
Shb A T 4: 45,489,154 S241T probably damaging Het
Slc47a2 A T 11: 61,302,292 L545Q probably damaging Het
Spef2 C A 15: 9,725,180 E164* probably null Het
Sphkap A T 1: 83,277,387 N880K possibly damaging Het
Taf2 A G 15: 55,036,535 V894A probably benign Het
Tgfa T G 6: 86,271,454 L146R probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tlr4 G A 4: 66,929,031 V132I probably benign Het
Tsen34 C T 7: 3,694,341 probably benign Het
Ttc13 T G 8: 124,683,237 K412T probably damaging Het
Unc45b A G 11: 82,913,212 I72V probably benign Het
Vmn1r195 A G 13: 22,278,969 Y203C probably damaging Het
Vmn2r65 T A 7: 84,946,457 T340S probably benign Het
Vmn2r88 T A 14: 51,411,136 C46S Het
Ythdf2 A T 4: 132,204,519 D443E probably damaging Het
Zeb2 T C 2: 44,996,784 R754G probably damaging Het
Zfp236 T A 18: 82,646,226 E478V probably damaging Het
Zfp287 A T 11: 62,714,310 Y590* probably null Het
Zfp9 A T 6: 118,465,262 C146* probably null Het
Other mutations in Scn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Scn1a APN 2 66335531 critical splice acceptor site probably null
IGL00650:Scn1a APN 2 66280793 missense probably damaging 1.00
IGL00658:Scn1a APN 2 66286038 missense probably damaging 1.00
IGL00823:Scn1a APN 2 66324935 missense probably benign 0.04
IGL00907:Scn1a APN 2 66327797 missense probably damaging 1.00
IGL01339:Scn1a APN 2 66325960 missense probably benign 0.09
IGL01401:Scn1a APN 2 66289111 missense probably damaging 1.00
IGL01503:Scn1a APN 2 66322343 missense probably damaging 1.00
IGL01575:Scn1a APN 2 66273236 missense probably damaging 1.00
IGL01598:Scn1a APN 2 66302485 missense possibly damaging 0.63
IGL01613:Scn1a APN 2 66285937 missense probably damaging 1.00
IGL01796:Scn1a APN 2 66332301 splice site probably benign
IGL02079:Scn1a APN 2 66323360 missense probably benign 0.14
IGL02171:Scn1a APN 2 66273199 missense probably damaging 1.00
IGL02335:Scn1a APN 2 66277661 missense possibly damaging 0.93
IGL02406:Scn1a APN 2 66326036 missense possibly damaging 0.88
IGL02436:Scn1a APN 2 66351153 missense probably benign 0.01
IGL02507:Scn1a APN 2 66277813 missense probably damaging 1.00
IGL02646:Scn1a APN 2 66299618 splice site probably null
IGL02729:Scn1a APN 2 66299650 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66324762 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66318077 missense probably benign 0.00
IGL02752:Scn1a APN 2 66331412 missense probably damaging 1.00
IGL02815:Scn1a APN 2 66324858 missense probably damaging 1.00
IGL03163:Scn1a APN 2 66318074 missense probably benign 0.00
IGL03229:Scn1a APN 2 66299713 missense probably damaging 1.00
IGL03286:Scn1a APN 2 66277576 missense probably damaging 0.99
IGL03393:Scn1a APN 2 66318018 missense probably benign 0.19
BB008:Scn1a UTSW 2 66317812 missense probably damaging 0.99
BB018:Scn1a UTSW 2 66317812 missense probably damaging 0.99
PIT4791001:Scn1a UTSW 2 66273282 missense probably benign 0.18
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0107:Scn1a UTSW 2 66324633 missense probably benign 0.07
R0141:Scn1a UTSW 2 66289062 missense probably damaging 1.00
R0485:Scn1a UTSW 2 66273925 missense probably damaging 0.98
R0517:Scn1a UTSW 2 66302407 missense possibly damaging 0.88
R0532:Scn1a UTSW 2 66317823 missense probably damaging 1.00
R0746:Scn1a UTSW 2 66351126 missense probably benign 0.25
R0755:Scn1a UTSW 2 66321035 missense probably damaging 1.00
R0830:Scn1a UTSW 2 66299784 missense probably damaging 1.00
R0846:Scn1a UTSW 2 66324755 missense probably benign 0.43
R0918:Scn1a UTSW 2 66323307 splice site probably null
R1055:Scn1a UTSW 2 66337996 missense probably benign 0.08
R1432:Scn1a UTSW 2 66322429 missense probably damaging 1.00
R1497:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R1512:Scn1a UTSW 2 66331285 missense possibly damaging 0.82
R1525:Scn1a UTSW 2 66319462 nonsense probably null
R1567:Scn1a UTSW 2 66273331 missense probably damaging 1.00
R1702:Scn1a UTSW 2 66318223 missense probably damaging 1.00
R1744:Scn1a UTSW 2 66322276 missense probably benign 0.06
R1834:Scn1a UTSW 2 66324616 missense probably benign 0.04
R1834:Scn1a UTSW 2 66324617 missense probably benign 0.00
R1860:Scn1a UTSW 2 66317982 missense probably damaging 0.99
R1871:Scn1a UTSW 2 66318025 missense probably damaging 0.98
R1909:Scn1a UTSW 2 66331352 missense possibly damaging 0.58
R1967:Scn1a UTSW 2 66328425 missense probably damaging 1.00
R1976:Scn1a UTSW 2 66331271 missense probably benign 0.02
R2291:Scn1a UTSW 2 66288968 missense probably benign 0.44
R2302:Scn1a UTSW 2 66277745 missense probably damaging 1.00
R2367:Scn1a UTSW 2 66327679 missense probably damaging 1.00
R2418:Scn1a UTSW 2 66273843 missense probably damaging 0.98
R2517:Scn1a UTSW 2 66273832 missense probably damaging 1.00
R2568:Scn1a UTSW 2 66273469 missense probably damaging 1.00
R3083:Scn1a UTSW 2 66299637 missense probably damaging 1.00
R3903:Scn1a UTSW 2 66318132 missense probably benign 0.08
R3909:Scn1a UTSW 2 66273988 missense probably damaging 1.00
R3916:Scn1a UTSW 2 66277613 missense probably damaging 1.00
R3935:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R3936:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R4043:Scn1a UTSW 2 66326036 missense possibly damaging 0.60
R4429:Scn1a UTSW 2 66350985 missense possibly damaging 0.77
R4495:Scn1a UTSW 2 66280802 critical splice acceptor site probably null
R4662:Scn1a UTSW 2 66350988 missense probably benign 0.23
R4834:Scn1a UTSW 2 66328522 nonsense probably null
R4873:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R4875:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R5099:Scn1a UTSW 2 66277801 missense probably damaging 1.00
R5255:Scn1a UTSW 2 66277669 missense probably damaging 0.99
R5435:Scn1a UTSW 2 66273534 missense probably damaging 1.00
R5449:Scn1a UTSW 2 66321002 missense probably damaging 0.96
R5519:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R5541:Scn1a UTSW 2 66324633 missense probably benign 0.07
R5556:Scn1a UTSW 2 66324797 missense probably benign 0.00
R5587:Scn1a UTSW 2 66273081 missense probably benign 0.01
R5972:Scn1a UTSW 2 66351110 missense possibly damaging 0.65
R5992:Scn1a UTSW 2 66335456 missense probably damaging 1.00
R6195:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6233:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6328:Scn1a UTSW 2 66273316 missense probably damaging 1.00
R6417:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6420:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6421:Scn1a UTSW 2 66272927 missense probably damaging 1.00
R6461:Scn1a UTSW 2 66326122 missense probably null 0.01
R6701:Scn1a UTSW 2 66337960 missense probably damaging 0.99
R6717:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R6834:Scn1a UTSW 2 66327742 missense probably damaging 1.00
R6918:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R6953:Scn1a UTSW 2 66319469 missense probably damaging 1.00
R6996:Scn1a UTSW 2 66287731 missense probably damaging 1.00
R7022:Scn1a UTSW 2 66317899 missense probably damaging 1.00
R7109:Scn1a UTSW 2 66350942 missense possibly damaging 0.62
R7115:Scn1a UTSW 2 66324618 nonsense probably null
R7239:Scn1a UTSW 2 66277656 splice site probably null
R7434:Scn1a UTSW 2 66273045 missense probably benign
R7646:Scn1a UTSW 2 66287758 missense possibly damaging 0.93
R7711:Scn1a UTSW 2 66303660 missense probably benign
R7879:Scn1a UTSW 2 66286005 nonsense probably null
R7931:Scn1a UTSW 2 66317812 missense probably damaging 0.99
R7962:Scn1a UTSW 2 66328442 missense probably damaging 1.00
R8025:Scn1a UTSW 2 66318213 missense probably benign 0.02
R8055:Scn1a UTSW 2 66319501 missense probably damaging 1.00
R8095:Scn1a UTSW 2 66302465 missense possibly damaging 0.93
R8167:Scn1a UTSW 2 66324838 missense probably damaging 0.98
R8339:Scn1a UTSW 2 66286029 missense probably damaging 1.00
R8363:Scn1a UTSW 2 66322257 missense probably damaging 1.00
R8516:Scn1a UTSW 2 66326134 missense possibly damaging 0.79
R8559:Scn1a UTSW 2 66287733 missense probably damaging 1.00
R8726:Scn1a UTSW 2 66303639 missense probably benign
R8733:Scn1a UTSW 2 66324600 missense probably benign
R8779:Scn1a UTSW 2 66350913 critical splice donor site probably benign
R8841:Scn1a UTSW 2 66326122 missense probably benign 0.09
R8919:Scn1a UTSW 2 66337986 missense probably benign 0.16
R9040:Scn1a UTSW 2 66317901 missense probably damaging 0.99
R9086:Scn1a UTSW 2 66351014 missense probably benign 0.01
R9176:Scn1a UTSW 2 66273345 missense probably damaging 1.00
R9228:Scn1a UTSW 2 66299755 missense probably benign 0.10
R9275:Scn1a UTSW 2 66299682 missense probably damaging 1.00
R9365:Scn1a UTSW 2 66318121 missense probably benign 0.10
R9478:Scn1a UTSW 2 66326149 missense probably benign 0.01
R9560:Scn1a UTSW 2 66327787 missense probably damaging 1.00
R9608:Scn1a UTSW 2 66322343 missense probably benign 0.02
R9624:Scn1a UTSW 2 66323422 missense probably benign
Z1176:Scn1a UTSW 2 66326128 missense possibly damaging 0.92
Z1177:Scn1a UTSW 2 66324952 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AATTTGCCAGACTTTGCACAG -3'
(R):5'- TTTGTCCCAATAGGTAGGTACTATG -3'

Sequencing Primer
(F):5'- TCTTACCTACAATGGAGAGGATGACC -3'
(R):5'- GCTGTCTACCAGGAATCTC -3'
Posted On 2021-08-02