Mutagenetix > Incidental Mutation

Incidental Mutation 'R8916:Rint1'

678931

Institutional Source

Beutler Lab

Gene Symbol

Rint1

Ensembl Gene

ENSMUSG00000028999

Gene Name

RAD50 interactor 1

Synonyms

2810450M21Rik, 1500019C06Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8916 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

23787711-23820369 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to T at 23787828 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114588 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113] [ENSMUST00000117783] [ENSMUST00000119946] [ENSMUST00000120869] [ENSMUST00000148618]

AlphaFold

Q8BZ36

Predicted Effect

probably benign
Transcript: ENSMUST00000030852

SMART Domains

Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999

Domain	Start	End	E-Value	Type
Pfam:RINT1_TIP1	304	784	2.3e-135	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115113

SMART Domains

Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999

Domain	Start	End	E-Value	Type
Pfam:RINT1_TIP1	246	727	1.2e-161	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117783

Predicted Effect

probably benign
Transcript: ENSMUST00000119946

SMART Domains

Protein: ENSMUSP00000113801
Gene: ENSMUSG00000057541

Domain	Start	End	E-Value	Type
low complexity region	77	99	N/A	INTRINSIC
Pfam:TruD	246	641	9e-69	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120869

Predicted Effect

probably benign
Transcript: ENSMUST00000148618

SMART Domains

Protein: ENSMUSP00000114588
Gene: ENSMUSG00000057541

Domain	Start	End	E-Value	Type
low complexity region	77	99	N/A	INTRINSIC
Pfam:TruD	251	647	6.3e-69	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	C	A	4: 42,973,034	P789H	probably damaging	Het
2210010C04Rik	T	A	6: 41,033,169	H77L	probably damaging	Het
Adamts16	A	G	13: 70,793,188	L360S	probably damaging	Het
AW554918	T	C	18: 25,289,992	Y167H	probably damaging	Het
Cdh18	A	T	15: 23,410,727	I433F	probably damaging	Het
Cenpj	A	T	14: 56,552,895	F566I	probably damaging	Het
Cntn4	T	A	6: 106,675,954	Y795N	probably damaging	Het
Col4a4	C	T	1: 82,523,946	G362E	unknown	Het
Crebrf	A	G	17: 26,739,609	T18A	probably damaging	Het
D130043K22Rik	G	A	13: 24,872,271	V529I	probably benign	Het
Dars2	T	C	1: 161,053,982	T326A	probably benign	Het
Eif4e	T	C	3: 138,550,282		probably benign	Het
Enpp2	T	C	15: 54,870,326	M413V	possibly damaging	Het
Fam129b	T	A	2: 32,921,094	M372K	possibly damaging	Het
Fam71a	A	G	1: 191,163,660	I262T	probably benign	Het
Fbn1	T	C	2: 125,403,229	D246G	possibly damaging	Het
Foxred2	A	G	15: 77,953,314	S241P	probably damaging	Het
Fras1	T	C	5: 96,752,915	F2998L	probably damaging	Het
Grb10	T	C	11: 11,951,599	T192A	probably benign	Het
Grid1	G	A	14: 35,321,707	D340N	probably damaging	Het
Heatr5a	AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA	AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA	12: 51,887,919		probably benign	Het
Hinfp	A	T	9: 44,298,376	F234I	probably damaging	Het
Hmcn1	A	T	1: 150,773,779	I652N	probably damaging	Het
Hrasls	A	G	16: 29,220,507	D113G	possibly damaging	Het
Kif24	T	C	4: 41,394,963	K771E	probably benign	Het
Lhcgr	A	G	17: 88,753,742		probably null	Het
Lnpk	A	T	2: 74,528,142	S358T	probably benign	Het
Lpcat2	A	T	8: 92,869,688	M118L	probably benign	Het
Lypd1	T	A	1: 125,873,383	T127S	unknown	Het
Mettl23	C	T	11: 116,849,285	T194I	probably damaging	Het
Mga	T	C	2: 119,958,338	V2227A	possibly damaging	Het
Mus81	A	T	19: 5,484,186	V368E	probably damaging	Het
Myo3a	T	A	2: 22,567,692	F1046I	probably damaging	Het
Nfia	G	A	4: 98,000,430	V222I	probably benign	Het
Nop9	A	G	14: 55,753,644	E586G	probably benign	Het
Nr2e1	G	A	10: 42,567,868	A286V	possibly damaging	Het
Nup153	G	A	13: 46,709,986	Q300*	probably null	Het
Pnp2	T	C	14: 50,963,777	L202P	probably damaging	Het
Psen2	A	G	1: 180,235,930	F183L	probably benign	Het
Rsf1	GGC	GGCGGCGGCCGC	7: 97,579,933		probably benign	Het
Ryr3	C	A	2: 112,778,290	R2335L	probably damaging	Het
Scn1a	T	C	2: 66,277,783	D1544G	probably damaging	Het
Sec31b	A	C	19: 44,532,344	S175A		Het
Sgcg	A	G	14: 61,236,892	S101P	probably damaging	Het
Shb	A	T	4: 45,489,154	S241T	probably damaging	Het
Slc47a2	A	T	11: 61,302,292	L545Q	probably damaging	Het
Spef2	C	A	15: 9,725,180	E164*	probably null	Het
Sphkap	A	T	1: 83,277,387	N880K	possibly damaging	Het
Taf2	A	G	15: 55,036,535	V894A	probably benign	Het
Tgfa	T	G	6: 86,271,454	L146R	probably damaging	Het
Tlr3	C	T	8: 45,403,039	V35I	probably benign	Het
Tlr4	G	A	4: 66,929,031	V132I	probably benign	Het
Tsen34	C	T	7: 3,694,341		probably benign	Het
Ttc13	T	G	8: 124,683,237	K412T	probably damaging	Het
Unc45b	A	G	11: 82,913,212	I72V	probably benign	Het
Vmn1r195	A	G	13: 22,278,969	Y203C	probably damaging	Het
Vmn2r65	T	A	7: 84,946,457	T340S	probably benign	Het
Vmn2r88	T	A	14: 51,411,136	C46S		Het
Ythdf2	A	T	4: 132,204,519	D443E	probably damaging	Het
Zeb2	T	C	2: 44,996,784	R754G	probably damaging	Het
Zfp236	T	A	18: 82,646,226	E478V	probably damaging	Het
Zfp287	A	T	11: 62,714,310	Y590*	probably null	Het
Zfp9	A	T	6: 118,465,262	C146*	probably null	Het

Other mutations in Rint1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rint1	APN	5	23794431	missense	probably benign	0.00
IGL00596:Rint1	APN	5	23811865	missense	probably damaging	0.99
IGL01685:Rint1	APN	5	23787834	unclassified	probably benign
IGL02428:Rint1	APN	5	23794452	nonsense	probably null
IGL03007:Rint1	APN	5	23815701	missense	probably benign	0.00
IGL03280:Rint1	APN	5	23817078	missense	probably damaging	1.00
breakage	UTSW	5	23800722	missense	probably damaging	0.99
IGL02799:Rint1	UTSW	5	23819480	missense	possibly damaging	0.93
R0062:Rint1	UTSW	5	23787828	unclassified	probably benign
R0243:Rint1	UTSW	5	23816932	splice site	probably benign
R1102:Rint1	UTSW	5	23805567	splice site	probably benign
R1552:Rint1	UTSW	5	23800658	missense	probably benign	0.00
R1729:Rint1	UTSW	5	23809843	missense	probably benign	0.00
R1784:Rint1	UTSW	5	23809843	missense	probably benign	0.00
R2070:Rint1	UTSW	5	23810929	missense	possibly damaging	0.94
R2920:Rint1	UTSW	5	23805402	missense	probably benign	0.00
R3114:Rint1	UTSW	5	23819420	missense	probably benign	0.27
R4398:Rint1	UTSW	5	23794447	missense	possibly damaging	0.55
R4756:Rint1	UTSW	5	23809793	missense	probably damaging	1.00
R5246:Rint1	UTSW	5	23800811	missense	probably damaging	0.99
R5452:Rint1	UTSW	5	23794365	missense	probably benign	0.01
R5566:Rint1	UTSW	5	23810953	missense	probably damaging	1.00
R5709:Rint1	UTSW	5	23815833	missense	probably damaging	0.98
R6524:Rint1	UTSW	5	23815739	missense	probably benign	0.00
R7346:Rint1	UTSW	5	23815653	missense	possibly damaging	0.82
R7549:Rint1	UTSW	5	23815704	missense	probably benign
R7634:Rint1	UTSW	5	23805479	missense	probably benign	0.00
R7647:Rint1	UTSW	5	23800802	missense	probably damaging	1.00
R7885:Rint1	UTSW	5	23805644	missense	probably benign
R7895:Rint1	UTSW	5	23800722	missense	probably damaging	0.99
R8347:Rint1	UTSW	5	23811772	missense	probably damaging	1.00
R8791:Rint1	UTSW	5	23800596	missense	probably damaging	0.99
R8900:Rint1	UTSW	5	23811884	missense	possibly damaging	0.77
R8973:Rint1	UTSW	5	23811730	missense	probably benign	0.00
R9245:Rint1	UTSW	5	23805413	missense	probably benign
R9339:Rint1	UTSW	5	23788357	makesense	probably null
R9630:Rint1	UTSW	5	23815812	missense	possibly damaging	0.82
R9718:Rint1	UTSW	5	23800723	missense	possibly damaging	0.53
Z1088:Rint1	UTSW	5	23805314	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGCAGATATGCCTCTCTAGG -3'
(R):5'- TTCTGGGACATCGGACATTGC -3'

Sequencing Primer
(F):5'- TCTCTAGGCCAAGAGAACGG -3'
(R):5'- ACATCGGACATTGCACTGTG -3'

Posted On

2021-08-02