Incidental Mutation 'R8916:D130043K22Rik'
ID 678952
Institutional Source Beutler Lab
Gene Symbol D130043K22Rik
Ensembl Gene ENSMUSG00000006711
Gene Name RIKEN cDNA D130043K22 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8916 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 24845135-24901270 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24872271 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 529 (V529I)
Ref Sequence ENSEMBL: ENSMUSP00000006893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]
AlphaFold Q5SZV5
Predicted Effect probably benign
Transcript: ENSMUST00000006893
AA Change: V529I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: V529I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 3e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
FN3 728 808 9.15e1 SMART
PKD 729 820 4.38e-10 SMART
transmembrane domain 965 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141572
AA Change: V529I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711
AA Change: V529I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 2e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C A 4: 42,973,034 P789H probably damaging Het
2210010C04Rik T A 6: 41,033,169 H77L probably damaging Het
Adamts16 A G 13: 70,793,188 L360S probably damaging Het
AW554918 T C 18: 25,289,992 Y167H probably damaging Het
Cdh18 A T 15: 23,410,727 I433F probably damaging Het
Cenpj A T 14: 56,552,895 F566I probably damaging Het
Cntn4 T A 6: 106,675,954 Y795N probably damaging Het
Col4a4 C T 1: 82,523,946 G362E unknown Het
Crebrf A G 17: 26,739,609 T18A probably damaging Het
Dars2 T C 1: 161,053,982 T326A probably benign Het
Eif4e T C 3: 138,550,282 probably benign Het
Enpp2 T C 15: 54,870,326 M413V possibly damaging Het
Fam129b T A 2: 32,921,094 M372K possibly damaging Het
Fam71a A G 1: 191,163,660 I262T probably benign Het
Fbn1 T C 2: 125,403,229 D246G possibly damaging Het
Foxred2 A G 15: 77,953,314 S241P probably damaging Het
Fras1 T C 5: 96,752,915 F2998L probably damaging Het
Grb10 T C 11: 11,951,599 T192A probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Hinfp A T 9: 44,298,376 F234I probably damaging Het
Hmcn1 A T 1: 150,773,779 I652N probably damaging Het
Hrasls A G 16: 29,220,507 D113G possibly damaging Het
Kif24 T C 4: 41,394,963 K771E probably benign Het
Lhcgr A G 17: 88,753,742 probably null Het
Lnpk A T 2: 74,528,142 S358T probably benign Het
Lpcat2 A T 8: 92,869,688 M118L probably benign Het
Lypd1 T A 1: 125,873,383 T127S unknown Het
Mettl23 C T 11: 116,849,285 T194I probably damaging Het
Mga T C 2: 119,958,338 V2227A possibly damaging Het
Mus81 A T 19: 5,484,186 V368E probably damaging Het
Myo3a T A 2: 22,567,692 F1046I probably damaging Het
Nfia G A 4: 98,000,430 V222I probably benign Het
Nop9 A G 14: 55,753,644 E586G probably benign Het
Nr2e1 G A 10: 42,567,868 A286V possibly damaging Het
Nup153 G A 13: 46,709,986 Q300* probably null Het
Pnp2 T C 14: 50,963,777 L202P probably damaging Het
Psen2 A G 1: 180,235,930 F183L probably benign Het
Rint1 G T 5: 23,787,828 probably benign Het
Rsf1 GGC GGCGGCGGCCGC 7: 97,579,933 probably benign Het
Ryr3 C A 2: 112,778,290 R2335L probably damaging Het
Scn1a T C 2: 66,277,783 D1544G probably damaging Het
Sec31b A C 19: 44,532,344 S175A Het
Sgcg A G 14: 61,236,892 S101P probably damaging Het
Shb A T 4: 45,489,154 S241T probably damaging Het
Slc47a2 A T 11: 61,302,292 L545Q probably damaging Het
Spef2 C A 15: 9,725,180 E164* probably null Het
Sphkap A T 1: 83,277,387 N880K possibly damaging Het
Taf2 A G 15: 55,036,535 V894A probably benign Het
Tgfa T G 6: 86,271,454 L146R probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tlr4 G A 4: 66,929,031 V132I probably benign Het
Tsen34 C T 7: 3,694,341 probably benign Het
Ttc13 T G 8: 124,683,237 K412T probably damaging Het
Unc45b A G 11: 82,913,212 I72V probably benign Het
Vmn1r195 A G 13: 22,278,969 Y203C probably damaging Het
Vmn2r65 T A 7: 84,946,457 T340S probably benign Het
Vmn2r88 T A 14: 51,411,136 C46S Het
Ythdf2 A T 4: 132,204,519 D443E probably damaging Het
Zeb2 T C 2: 44,996,784 R754G probably damaging Het
Zfp236 T A 18: 82,646,226 E478V probably damaging Het
Zfp287 A T 11: 62,714,310 Y590* probably null Het
Zfp9 A T 6: 118,465,262 C146* probably null Het
Other mutations in D130043K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:D130043K22Rik APN 13 24867174 missense probably damaging 1.00
IGL01114:D130043K22Rik APN 13 24857156 missense probably damaging 0.99
IGL01412:D130043K22Rik APN 13 24887860 missense probably damaging 1.00
IGL01542:D130043K22Rik APN 13 24876037 splice site probably null
IGL01615:D130043K22Rik APN 13 24899796 missense probably damaging 1.00
IGL01705:D130043K22Rik APN 13 24857941 missense probably benign 0.00
IGL02220:D130043K22Rik APN 13 24883755 missense possibly damaging 0.95
IGL02229:D130043K22Rik APN 13 24875924 missense probably damaging 1.00
IGL02576:D130043K22Rik APN 13 24856870 missense possibly damaging 0.74
IGL03038:D130043K22Rik APN 13 24879619 missense probably damaging 1.00
IGL03117:D130043K22Rik APN 13 24889842 missense probably damaging 1.00
IGL03014:D130043K22Rik UTSW 13 24858092 missense possibly damaging 0.88
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0020:D130043K22Rik UTSW 13 24854492 utr 5 prime probably benign
R0172:D130043K22Rik UTSW 13 24872406 missense probably benign 0.16
R0276:D130043K22Rik UTSW 13 24858045 missense possibly damaging 0.92
R0304:D130043K22Rik UTSW 13 24864815 missense probably benign 0.07
R0335:D130043K22Rik UTSW 13 24887877 missense probably damaging 0.98
R0744:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0833:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0836:D130043K22Rik UTSW 13 24863580 splice site probably benign
R1270:D130043K22Rik UTSW 13 24857338 missense probably benign 0.00
R1433:D130043K22Rik UTSW 13 24871341 missense probably damaging 1.00
R1682:D130043K22Rik UTSW 13 24882556 missense probably damaging 1.00
R1772:D130043K22Rik UTSW 13 24875999 missense probably damaging 1.00
R1773:D130043K22Rik UTSW 13 24882602 missense possibly damaging 0.80
R1800:D130043K22Rik UTSW 13 24883894 missense probably damaging 1.00
R1956:D130043K22Rik UTSW 13 24885595 missense probably damaging 1.00
R2255:D130043K22Rik UTSW 13 24856911 missense probably damaging 1.00
R2445:D130043K22Rik UTSW 13 24857036 missense probably benign 0.04
R2568:D130043K22Rik UTSW 13 24883891 missense probably damaging 0.97
R4160:D130043K22Rik UTSW 13 24862696 missense probably benign 0.02
R4494:D130043K22Rik UTSW 13 24871356 missense probably benign 0.16
R4732:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4733:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4782:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4799:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4864:D130043K22Rik UTSW 13 24863612 missense probably damaging 1.00
R5155:D130043K22Rik UTSW 13 24872290 missense probably damaging 1.00
R5240:D130043K22Rik UTSW 13 24877977 missense probably damaging 1.00
R5383:D130043K22Rik UTSW 13 24857414 missense probably benign 0.02
R5493:D130043K22Rik UTSW 13 24863603 missense probably damaging 1.00
R6184:D130043K22Rik UTSW 13 24885591 missense probably damaging 1.00
R6305:D130043K22Rik UTSW 13 24885685 missense probably damaging 1.00
R6436:D130043K22Rik UTSW 13 24877935 missense probably damaging 1.00
R6980:D130043K22Rik UTSW 13 24864781 missense probably damaging 0.98
R7038:D130043K22Rik UTSW 13 24893408 missense probably damaging 1.00
R7085:D130043K22Rik UTSW 13 24872302 missense possibly damaging 0.95
R7147:D130043K22Rik UTSW 13 24882563 missense probably benign 0.31
R7384:D130043K22Rik UTSW 13 24882605 missense probably damaging 1.00
R7398:D130043K22Rik UTSW 13 24893377 missense probably damaging 0.97
R7584:D130043K22Rik UTSW 13 24872370 missense probably damaging 1.00
R7585:D130043K22Rik UTSW 13 24885585 missense probably benign 0.01
R7588:D130043K22Rik UTSW 13 24887893 missense probably damaging 0.99
R7610:D130043K22Rik UTSW 13 24876002 missense probably benign 0.30
R7903:D130043K22Rik UTSW 13 24876012 missense probably damaging 0.98
R7966:D130043K22Rik UTSW 13 24893423 missense probably damaging 1.00
R8014:D130043K22Rik UTSW 13 24856702 missense probably damaging 1.00
R8374:D130043K22Rik UTSW 13 24857979 missense probably benign 0.07
R8543:D130043K22Rik UTSW 13 24889869 missense probably benign 0.08
R8775:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8775-TAIL:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8806:D130043K22Rik UTSW 13 24899635 missense probably benign 0.11
R9209:D130043K22Rik UTSW 13 24857107 missense possibly damaging 0.96
R9524:D130043K22Rik UTSW 13 24887893 missense possibly damaging 0.89
Z1177:D130043K22Rik UTSW 13 24856709 missense probably damaging 1.00
Z1177:D130043K22Rik UTSW 13 24856834 missense probably benign 0.39
Z1177:D130043K22Rik UTSW 13 24872248 missense possibly damaging 0.79
Z1177:D130043K22Rik UTSW 13 24880847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCACTCAGCATCTCAGAG -3'
(R):5'- GATGACTTGCCTGCATGACC -3'

Sequencing Primer
(F):5'- GTGGGAACATTTTGTGACTCAAAG -3'
(R):5'- GACTTGCCTGCATGACCATCTC -3'
Posted On 2021-08-02