Incidental Mutation 'R8916:Grid1'
ID678955
Institutional Source Beutler Lab
Gene Symbol Grid1
Ensembl Gene ENSMUSG00000041078
Gene Nameglutamate receptor, ionotropic, delta 1
SynonymsGluRdelta1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8916 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34820108-35583379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35321707 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 340 (D340N)
Ref Sequence ENSEMBL: ENSMUSP00000044009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043349]
Predicted Effect probably damaging
Transcript: ENSMUST00000043349
AA Change: D340N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: D340N

DomainStartEndE-ValueType
Pfam:ANF_receptor 36 400 4.1e-51 PFAM
PBPe 438 807 4.68e-110 SMART
Lig_chan-Glu_bd 448 510 8.18e-25 SMART
low complexity region 838 853 N/A INTRINSIC
low complexity region 943 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C A 4: 42,973,034 P789H probably damaging Het
2210010C04Rik T A 6: 41,033,169 H77L probably damaging Het
Adamts16 A G 13: 70,793,188 L360S probably damaging Het
AW554918 T C 18: 25,289,992 Y167H probably damaging Het
Cdh18 A T 15: 23,410,727 I433F probably damaging Het
Cenpj A T 14: 56,552,895 F566I probably damaging Het
Cntn4 T A 6: 106,675,954 Y795N probably damaging Het
Col4a4 C T 1: 82,523,946 G362E unknown Het
Crebrf A G 17: 26,739,609 T18A probably damaging Het
D130043K22Rik G A 13: 24,872,271 V529I probably benign Het
Dars2 T C 1: 161,053,982 T326A probably benign Het
Eif4e T C 3: 138,550,282 probably benign Het
Enpp2 T C 15: 54,870,326 M413V possibly damaging Het
Fam129b T A 2: 32,921,094 M372K possibly damaging Het
Fam71a A G 1: 191,163,660 I262T probably benign Het
Fbn1 T C 2: 125,403,229 D246G possibly damaging Het
Foxred2 A G 15: 77,953,314 S241P probably damaging Het
Fras1 T C 5: 96,752,915 F2998L probably damaging Het
Grb10 T C 11: 11,951,599 T192A probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Hinfp A T 9: 44,298,376 F234I probably damaging Het
Hmcn1 A T 1: 150,773,779 I652N probably damaging Het
Hrasls A G 16: 29,220,507 D113G possibly damaging Het
Kif24 T C 4: 41,394,963 K771E probably benign Het
Lhcgr A G 17: 88,753,742 probably null Het
Lnpk A T 2: 74,528,142 S358T probably benign Het
Lpcat2 A T 8: 92,869,688 M118L probably benign Het
Lypd1 T A 1: 125,873,383 T127S unknown Het
Mettl23 C T 11: 116,849,285 T194I probably damaging Het
Mga T C 2: 119,958,338 V2227A possibly damaging Het
Mus81 A T 19: 5,484,186 V368E probably damaging Het
Myo3a T A 2: 22,567,692 F1046I probably damaging Het
Nfia G A 4: 98,000,430 V222I probably benign Het
Nop9 A G 14: 55,753,644 E586G probably benign Het
Nr2e1 G A 10: 42,567,868 A286V possibly damaging Het
Nup153 G A 13: 46,709,986 Q300* probably null Het
Pnp2 T C 14: 50,963,777 L202P probably damaging Het
Psen2 A G 1: 180,235,930 F183L probably benign Het
Rint1 G T 5: 23,787,828 probably benign Het
Rsf1 GGC GGCGGCGGCCGC 7: 97,579,933 probably benign Het
Ryr3 C A 2: 112,778,290 R2335L probably damaging Het
Scn1a T C 2: 66,277,783 D1544G probably damaging Het
Sec31b A C 19: 44,532,344 S175A Het
Sgcg A G 14: 61,236,892 S101P probably damaging Het
Shb A T 4: 45,489,154 S241T probably damaging Het
Slc47a2 A T 11: 61,302,292 L545Q probably damaging Het
Spef2 C A 15: 9,725,180 E164* probably null Het
Sphkap A T 1: 83,277,387 N880K possibly damaging Het
Taf2 A G 15: 55,036,535 V894A probably benign Het
Tgfa T G 6: 86,271,454 L146R probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tlr4 G A 4: 66,929,031 V132I probably benign Het
Tsen34 C T 7: 3,694,341 probably benign Het
Ttc13 T G 8: 124,683,237 K412T probably damaging Het
Unc45b A G 11: 82,913,212 I72V probably benign Het
Vmn1r195 A G 13: 22,278,969 Y203C probably damaging Het
Vmn2r65 T A 7: 84,946,457 T340S probably benign Het
Vmn2r88 T A 14: 51,411,136 C46S Het
Ythdf2 A T 4: 132,204,519 D443E probably damaging Het
Zeb2 T C 2: 44,996,784 R754G probably damaging Het
Zfp236 T A 18: 82,646,226 E478V probably damaging Het
Zfp287 A T 11: 62,714,310 Y590* probably null Het
Zfp9 A T 6: 118,465,262 C146* probably null Het
Other mutations in Grid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Grid1 APN 14 35445887 missense possibly damaging 0.70
IGL01016:Grid1 APN 14 34822639 nonsense probably null
IGL01643:Grid1 APN 14 35323435 critical splice donor site probably null
IGL01697:Grid1 APN 14 35309257 missense probably benign 0.21
IGL01879:Grid1 APN 14 35450370 missense possibly damaging 0.93
IGL01975:Grid1 APN 14 35323426 missense probably benign
IGL02515:Grid1 APN 14 35452345 missense probably damaging 0.99
IGL02935:Grid1 APN 14 34822558 missense possibly damaging 0.86
IGL03279:Grid1 APN 14 34945765 missense probably damaging 0.98
IGL03286:Grid1 APN 14 35520685 splice site probably benign
IGL03296:Grid1 APN 14 35580567 missense possibly damaging 0.52
IGL03305:Grid1 APN 14 35251707 missense probably damaging 1.00
R0533:Grid1 UTSW 14 35309385 missense possibly damaging 0.84
R0746:Grid1 UTSW 14 34822690 missense possibly damaging 0.92
R0811:Grid1 UTSW 14 34822619 missense probably benign
R0812:Grid1 UTSW 14 34822619 missense probably benign
R1144:Grid1 UTSW 14 35562676 splice site probably benign
R1217:Grid1 UTSW 14 34820229 start codon destroyed probably null 0.53
R1485:Grid1 UTSW 14 34822583 missense probably damaging 1.00
R1529:Grid1 UTSW 14 35309293 missense probably benign 0.36
R1606:Grid1 UTSW 14 35445965 missense probably damaging 0.96
R1691:Grid1 UTSW 14 35452329 missense probably damaging 1.00
R1759:Grid1 UTSW 14 35446031 missense possibly damaging 0.92
R2374:Grid1 UTSW 14 35321807 splice site probably benign
R2415:Grid1 UTSW 14 35450369 missense possibly damaging 0.69
R2866:Grid1 UTSW 14 35562559 missense probably damaging 1.00
R3915:Grid1 UTSW 14 35520727 missense probably damaging 1.00
R4044:Grid1 UTSW 14 35450401 splice site probably benign
R4364:Grid1 UTSW 14 34946032 missense probably benign 0.20
R4691:Grid1 UTSW 14 35569557 missense probably benign
R4694:Grid1 UTSW 14 35026780 missense probably damaging 1.00
R4749:Grid1 UTSW 14 35580687 missense possibly damaging 0.50
R4794:Grid1 UTSW 14 34822622 missense probably damaging 0.99
R4854:Grid1 UTSW 14 35321641 missense probably benign
R5555:Grid1 UTSW 14 35520705 missense possibly damaging 0.92
R6005:Grid1 UTSW 14 35323412 missense probably damaging 1.00
R6176:Grid1 UTSW 14 35562547 missense probably benign 0.00
R6569:Grid1 UTSW 14 35323339 missense possibly damaging 0.72
R6911:Grid1 UTSW 14 34820228 start codon destroyed probably benign 0.08
R7504:Grid1 UTSW 14 35562513 missense probably damaging 1.00
R7744:Grid1 UTSW 14 35450079 missense probably damaging 1.00
R7795:Grid1 UTSW 14 35321685 missense probably damaging 1.00
R7883:Grid1 UTSW 14 35450302 splice site probably null
R7913:Grid1 UTSW 14 35569697 missense probably damaging 0.99
R8032:Grid1 UTSW 14 35323359 missense probably benign 0.00
R8333:Grid1 UTSW 14 35569638 missense possibly damaging 0.82
R8934:Grid1 UTSW 14 35321707 missense probably damaging 1.00
R8935:Grid1 UTSW 14 35321707 missense probably damaging 1.00
R8939:Grid1 UTSW 14 35321707 missense probably damaging 1.00
R8986:Grid1 UTSW 14 35321707 missense probably damaging 1.00
R8993:Grid1 UTSW 14 35026942 missense probably benign 0.00
U24488:Grid1 UTSW 14 35580577 missense probably benign 0.00
Z1088:Grid1 UTSW 14 35452294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGATGAGCTGCTGAAAACAAAC -3'
(R):5'- TGTACCAACTAAGTGGGAGTGC -3'

Sequencing Primer
(F):5'- CTCACAGGACCAGGAAGATACTGTTG -3'
(R):5'- CAATAATGAGGGCCTTGTCTCCAG -3'
Posted On2021-08-02