Mutagenetix > Incidental Mutation

Incidental Mutation 'R8917:Thnsl2'

678992

Institutional Source

Beutler Lab

Gene Symbol

Thnsl2

Ensembl Gene

ENSMUSG00000054474

Gene Name

threonine synthase-like 2 (bacterial)

Synonyms

TSH2

MMRRC Submission

068704-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R8917 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71128166-71144439 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71139943 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 75 (D75G)

Ref Sequence

ENSEMBL: ENSMUSP00000124423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074241] [ENSMUST00000160918]

AlphaFold

Q80W22

Predicted Effect

probably benign
Transcript: ENSMUST00000074241
AA Change: D75G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073861
Gene: ENSMUSG00000054474
AA Change: D75G

Domain	Start	End	E-Value	Type
Pfam:Thr_synth_N	2	81	2.4e-27	PFAM
Pfam:PALP	93	415	9.6e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160918
AA Change: D75G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000124423
Gene: ENSMUSG00000054474
AA Change: D75G

Domain	Start	End	E-Value	Type
Pfam:Thr_synth_N	2	81	1.1e-27	PFAM
Pfam:PALP	94	413	8.4e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a threonine synthase-like protein. A similar enzyme in mouse can catalyze the degradation of O-phospho-homoserine to a-ketobutyrate, phosphate, and ammonia. This protein also has phospho-lyase activity on both gamma and beta phosphorylated substrates. In mouse an alternatively spliced form of this protein has been shown to act as a cytokine and can induce the production of the inflammatory cytokine IL6 in osteoblasts. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	G	1: 37,637,912	V63A	probably damaging	Het
2610528J11Rik	A	G	4: 118,529,293	M1V	probably null	Het
Acss3	T	C	10: 106,937,263	S621G	probably benign	Het
Adam1a	C	T	5: 121,519,082	R716Q	probably benign	Het
Ankrd26	G	T	6: 118,558,941	N177K	probably damaging	Het
Ankrd31	G	A	13: 96,832,704	V950I	probably damaging	Het
Ano4	A	G	10: 88,952,298	Y922H	probably damaging	Het
Axin2	A	T	11: 108,931,515	N298Y	probably damaging	Het
Celsr2	A	T	3: 108,396,566	M2392K	probably benign	Het
Coasy	A	G	11: 101,083,376	S123G	probably benign	Het
Ctla2a	A	T	13: 60,936,040	M26K	probably benign	Het
Cts8	A	T	13: 61,249,068		probably benign	Het
Cyp4a30b	C	A	4: 115,454,465	S110*	probably null	Het
Eif2ak4	A	G	2: 118,457,136	Y1195C	probably damaging	Het
Erh	G	T	12: 80,637,508	A65E	probably benign	Het
Exoc6	A	G	19: 37,589,912	D401G	probably benign	Het
Fmo1	A	G	1: 162,836,204	V252A	probably benign	Het
Furin	T	C	7: 80,398,689	K28E	probably benign	Het
Gm12800	G	A	4: 101,911,738	V429M	probably benign	Het
Gm9268	T	C	7: 43,048,009	I830T	probably damaging	Het
Gmip	T	A	8: 69,817,778	F713I	probably damaging	Het
Hyal6	T	C	6: 24,734,104	L12P	possibly damaging	Het
Ido1	T	C	8: 24,591,507	N144D	probably benign	Het
Igsf10	T	A	3: 59,319,467	T2262S	possibly damaging	Het
Insrr	T	C	3: 87,810,969	F923S	probably benign	Het
Kank1	G	T	19: 25,409,564	M200I	probably damaging	Het
Kctd15	A	G	7: 34,642,083	Y140H	probably damaging	Het
Kif3c	T	A	12: 3,366,690	I237N	probably damaging	Het
Klhl26	T	C	8: 70,452,805	S152G	possibly damaging	Het
Lce1k	C	A	3: 92,806,790	C29F	unknown	Het
Map1a	A	G	2: 121,301,310	E869G	possibly damaging	Het
Mcmbp	T	C	7: 128,698,557	E576G	probably benign	Het
Mrps22	A	G	9: 98,594,110	V231A	probably benign	Het
Myo1a	C	T	10: 127,715,665	L697F	possibly damaging	Het
Ncapd3	T	C	9: 27,088,001	V1291A	probably benign	Het
Olfr1154	A	T	2: 87,902,963	S238T	possibly damaging	Het
Pcdhb6	A	G	18: 37,335,378	T451A	possibly damaging	Het
Pdzd3	T	A	9: 44,248,844		probably benign	Het
Pi4ka	C	A	16: 17,312,446	W1032L		Het
Pkhd1l1	T	A	15: 44,533,007	I1975N	probably benign	Het
Pnpla6	T	C	8: 3,517,637	M115T	possibly damaging	Het
Poldip2	G	A	11: 78,521,841	R347Q	probably damaging	Het
Rapgef6	C	T	11: 54,691,566	Q1440*	probably null	Het
Rtn3	A	T	19: 7,456,740	I629K	possibly damaging	Het
Selenov	A	G	7: 28,288,303	F278L	probably damaging	Het
Skor2	G	A	18: 76,860,809	G742D	probably damaging	Het
Spata31d1c	C	T	13: 65,035,615	P324S	probably benign	Het
Tbc1d14	A	T	5: 36,519,338	I403N	probably damaging	Het
Tekt3	A	T	11: 63,087,226	Q374L	probably damaging	Het
Tg	T	C	15: 66,773,483		probably null	Het
Tnr	A	T	1: 159,874,122	K598*	probably null	Het
Tshr	T	A	12: 91,502,055		probably benign	Het
Uggt1	A	G	1: 36,146,654	S1483P		Het
Usp42	T	C	5: 143,715,940	E776G		Het
Vmn2r118	T	C	17: 55,610,216	E432G	possibly damaging	Het
Zfhx4	A	G	3: 5,399,099	E1464G	probably damaging	Het
Zfp518a	A	C	19: 40,913,426	K600Q	possibly damaging	Het
Zxdc	A	G	6: 90,382,323	T646A	probably benign	Het

Other mutations in Thnsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Thnsl2	APN	6	71131900	missense	probably damaging	1.00
IGL00814:Thnsl2	APN	6	71139883	missense	probably damaging	1.00
IGL01139:Thnsl2	APN	6	71138734	missense	probably damaging	1.00
IGL01380:Thnsl2	APN	6	71138756	missense	probably benign
IGL01511:Thnsl2	APN	6	71139793	missense	probably benign	0.04
IGL02000:Thnsl2	APN	6	71134219	missense	probably damaging	1.00
IGL03157:Thnsl2	APN	6	71131946	missense	probably benign	0.00
R0372:Thnsl2	UTSW	6	71139790	missense	probably damaging	1.00
R0380:Thnsl2	UTSW	6	71141330	missense	probably damaging	1.00
R0521:Thnsl2	UTSW	6	71134259	missense	probably damaging	1.00
R0815:Thnsl2	UTSW	6	71134224	nonsense	probably null
R0863:Thnsl2	UTSW	6	71134224	nonsense	probably null
R1300:Thnsl2	UTSW	6	71134191	missense	probably damaging	1.00
R2867:Thnsl2	UTSW	6	71131961	missense	probably damaging	1.00
R2867:Thnsl2	UTSW	6	71131961	missense	probably damaging	1.00
R4767:Thnsl2	UTSW	6	71134295	missense	probably damaging	1.00
R5578:Thnsl2	UTSW	6	71138765	missense	probably benign	0.40
R5818:Thnsl2	UTSW	6	71134143	missense	probably benign	0.01
R6627:Thnsl2	UTSW	6	71134215	missense	possibly damaging	0.70
R6800:Thnsl2	UTSW	6	71141280	missense	probably benign	0.29
R7192:Thnsl2	UTSW	6	71139755	missense	probably benign	0.02
R7391:Thnsl2	UTSW	6	71131930	missense	probably damaging	1.00
R7516:Thnsl2	UTSW	6	71132006	nonsense	probably null
R7565:Thnsl2	UTSW	6	71141327	missense	probably benign	0.00
R7980:Thnsl2	UTSW	6	71138668	missense	probably damaging	1.00
R7988:Thnsl2	UTSW	6	71141319	missense	probably benign	0.38
R8170:Thnsl2	UTSW	6	71129333	missense	probably benign	0.05
R9547:Thnsl2	UTSW	6	71139826	missense	probably damaging	1.00
R9696:Thnsl2	UTSW	6	71131946	missense	possibly damaging	0.95
X0021:Thnsl2	UTSW	6	71128704	missense	probably benign	0.02
X0066:Thnsl2	UTSW	6	71139837	nonsense	probably null
Z1177:Thnsl2	UTSW	6	71128841	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TATACCGTGCATTGGCGTCC -3'
(R):5'- GCAGTTTAATACATGCCCTCCC -3'

Sequencing Primer
(F):5'- GGAGGGCTAAAAACTCCTGCTC -3'
(R):5'- CAGATTTTTCTAGACCCGTGCAATC -3'

Posted On

2021-08-02