Incidental Mutation 'R8917:Tg'
ID 679020
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Name thyroglobulin
Synonyms Tgn
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R8917 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 66670753-66850721 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 66773483 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000171045]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000065916
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171045
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,912 V63A probably damaging Het
2610528J11Rik A G 4: 118,529,293 M1V probably null Het
Acss3 T C 10: 106,937,263 S621G probably benign Het
Adam1a C T 5: 121,519,082 R716Q probably benign Het
Ankrd26 G T 6: 118,558,941 N177K probably damaging Het
Ankrd31 G A 13: 96,832,704 V950I probably damaging Het
Ano4 A G 10: 88,952,298 Y922H probably damaging Het
Axin2 A T 11: 108,931,515 N298Y probably damaging Het
Celsr2 A T 3: 108,396,566 M2392K probably benign Het
Coasy A G 11: 101,083,376 S123G probably benign Het
Ctla2a A T 13: 60,936,040 M26K probably benign Het
Cts8 A T 13: 61,249,068 probably benign Het
Cyp4a30b C A 4: 115,454,465 S110* probably null Het
Eif2ak4 A G 2: 118,457,136 Y1195C probably damaging Het
Erh G T 12: 80,637,508 A65E probably benign Het
Exoc6 A G 19: 37,589,912 D401G probably benign Het
Fmo1 A G 1: 162,836,204 V252A probably benign Het
Furin T C 7: 80,398,689 K28E probably benign Het
Gm12800 G A 4: 101,911,738 V429M probably benign Het
Gm9268 T C 7: 43,048,009 I830T probably damaging Het
Gmip T A 8: 69,817,778 F713I probably damaging Het
Hyal6 T C 6: 24,734,104 L12P possibly damaging Het
Ido1 T C 8: 24,591,507 N144D probably benign Het
Igsf10 T A 3: 59,319,467 T2262S possibly damaging Het
Insrr T C 3: 87,810,969 F923S probably benign Het
Kank1 G T 19: 25,409,564 M200I probably damaging Het
Kctd15 A G 7: 34,642,083 Y140H probably damaging Het
Kif3c T A 12: 3,366,690 I237N probably damaging Het
Klhl26 T C 8: 70,452,805 S152G possibly damaging Het
Lce1k C A 3: 92,806,790 C29F unknown Het
Map1a A G 2: 121,301,310 E869G possibly damaging Het
Mcmbp T C 7: 128,698,557 E576G probably benign Het
Mrps22 A G 9: 98,594,110 V231A probably benign Het
Myo1a C T 10: 127,715,665 L697F possibly damaging Het
Ncapd3 T C 9: 27,088,001 V1291A probably benign Het
Olfr1154 A T 2: 87,902,963 S238T possibly damaging Het
Pcdhb6 A G 18: 37,335,378 T451A possibly damaging Het
Pdzd3 T A 9: 44,248,844 probably benign Het
Pi4ka C A 16: 17,312,446 W1032L Het
Pkhd1l1 T A 15: 44,533,007 I1975N probably benign Het
Pnpla6 T C 8: 3,517,637 M115T possibly damaging Het
Poldip2 G A 11: 78,521,841 R347Q probably damaging Het
Rapgef6 C T 11: 54,691,566 Q1440* probably null Het
Rtn3 A T 19: 7,456,740 I629K possibly damaging Het
Selenov A G 7: 28,288,303 F278L probably damaging Het
Skor2 G A 18: 76,860,809 G742D probably damaging Het
Spata31d1c C T 13: 65,035,615 P324S probably benign Het
Tbc1d14 A T 5: 36,519,338 I403N probably damaging Het
Tekt3 A T 11: 63,087,226 Q374L probably damaging Het
Thnsl2 T C 6: 71,139,943 D75G probably benign Het
Tnr A T 1: 159,874,122 K598* probably null Het
Tshr T A 12: 91,502,055 probably benign Het
Uggt1 A G 1: 36,146,654 S1483P Het
Usp42 T C 5: 143,715,940 E776G Het
Vmn2r118 T C 17: 55,610,216 E432G possibly damaging Het
Zfhx4 A G 3: 5,399,099 E1464G probably damaging Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Zxdc A G 6: 90,382,323 T646A probably benign Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66847166 missense probably damaging 1.00
IGL00230:Tg APN 15 66827290 missense probably benign 0.00
IGL00324:Tg APN 15 66693424 missense probably benign
IGL00428:Tg APN 15 66773424 missense probably benign 0.33
IGL00703:Tg APN 15 66696489 missense probably benign 0.34
IGL00808:Tg APN 15 66683813 missense probably damaging 1.00
IGL00833:Tg APN 15 66688801 missense probably benign 0.34
IGL00899:Tg APN 15 66674073 critical splice donor site probably null
IGL00921:Tg APN 15 66764453 missense probably benign 0.28
IGL00975:Tg APN 15 66681882 missense probably benign
IGL01288:Tg APN 15 66736276 missense possibly damaging 0.81
IGL01397:Tg APN 15 66696092 splice site probably benign
IGL01634:Tg APN 15 66729566 missense probably benign 0.34
IGL01646:Tg APN 15 66678087 missense probably damaging 1.00
IGL01704:Tg APN 15 66671351 missense probably damaging 0.98
IGL01958:Tg APN 15 66759486 missense probably benign 0.06
IGL02093:Tg APN 15 66692374 missense possibly damaging 0.83
IGL02113:Tg APN 15 66705330 missense probably benign 0.08
IGL02138:Tg APN 15 66717233 missense probably benign 0.01
IGL02156:Tg APN 15 66705348 missense probably benign 0.19
IGL02169:Tg APN 15 66757943 missense probably benign 0.04
IGL02342:Tg APN 15 66764291 missense probably benign
IGL02434:Tg APN 15 66764342 missense probably damaging 0.97
IGL02506:Tg APN 15 66741594 missense possibly damaging 0.71
IGL02513:Tg APN 15 66705274 missense probably benign
IGL02549:Tg APN 15 66839361 missense probably damaging 1.00
IGL02669:Tg APN 15 66748726 splice site probably benign
IGL02756:Tg APN 15 66734586 missense probably benign
IGL02800:Tg APN 15 66757886 missense probably damaging 1.00
IGL02828:Tg APN 15 66682394 missense probably damaging 1.00
IGL02927:Tg APN 15 66678093 missense probably damaging 1.00
IGL03061:Tg APN 15 66671405 missense probably damaging 1.00
IGL03105:Tg APN 15 66715106 missense probably benign 0.01
IGL03160:Tg APN 15 66839303 nonsense probably null
IGL03242:Tg APN 15 66683798 missense probably damaging 0.99
Also_ran UTSW 15 66678839 missense probably damaging 1.00
bedraggled UTSW 15 66740714 missense probably damaging 1.00
foster UTSW 15 66693260 nonsense probably null
hognose UTSW 15 66717208 missense probably damaging 0.99
ito UTSW 15 66766162 nonsense probably null
ito2 UTSW 15 66671396 missense probably damaging 1.00
ito3 UTSW 15 66773474 missense probably damaging 1.00
ito4 UTSW 15 66696520 missense possibly damaging 0.47
Papua UTSW 15 66674050 missense probably damaging 1.00
Pipistrella UTSW 15 66696135 missense probably damaging 1.00
pluribus UTSW 15 66715163 missense probably damaging 0.98
samarai UTSW 15 66758006 critical splice donor site probably null
sariba UTSW 15 66694870 missense probably benign 0.01
ticker UTSW 15 66827382 nonsense probably null
Vampire UTSW 15 66682827 missense probably damaging 1.00
IGL03134:Tg UTSW 15 66740718 missense probably damaging 1.00
P0019:Tg UTSW 15 66688863 missense probably benign 0.01
R0121:Tg UTSW 15 66740781 missense probably benign 0.04
R0135:Tg UTSW 15 66694870 missense probably benign 0.01
R0227:Tg UTSW 15 66698446 missense possibly damaging 0.84
R0448:Tg UTSW 15 66764442 missense probably damaging 1.00
R0453:Tg UTSW 15 66828533 missense probably benign 0.09
R0504:Tg UTSW 15 66682404 missense probably damaging 0.97
R0543:Tg UTSW 15 66729597 missense probably benign 0.13
R0638:Tg UTSW 15 66717208 missense probably damaging 0.99
R0639:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0646:Tg UTSW 15 66729626 missense probably damaging 0.99
R0666:Tg UTSW 15 66737521 missense probably benign
R0673:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0689:Tg UTSW 15 66839404 splice site probably benign
R0704:Tg UTSW 15 66757880 missense probably benign 0.02
R0730:Tg UTSW 15 66678789 missense probably damaging 1.00
R0830:Tg UTSW 15 66725144 missense probably damaging 1.00
R0959:Tg UTSW 15 66708010 missense probably damaging 0.98
R1027:Tg UTSW 15 66672409 missense possibly damaging 0.65
R1061:Tg UTSW 15 66698559 missense probably benign 0.09
R1086:Tg UTSW 15 66684062 missense probably benign
R1103:Tg UTSW 15 66719655 missense probably benign 0.45
R1240:Tg UTSW 15 66828548 missense probably benign 0.16
R1281:Tg UTSW 15 66696489 missense probably benign 0.34
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1531:Tg UTSW 15 66850502 missense probably benign 0.02
R1544:Tg UTSW 15 66705232 missense probably benign 0.04
R1550:Tg UTSW 15 66693430 missense possibly damaging 0.52
R1575:Tg UTSW 15 66729685 critical splice donor site probably null
R1638:Tg UTSW 15 66696166 nonsense probably null
R1655:Tg UTSW 15 66828568 critical splice donor site probably null
R1671:Tg UTSW 15 66692387 missense possibly damaging 0.89
R1789:Tg UTSW 15 66737548 missense probably benign 0.00
R1883:Tg UTSW 15 66671309 missense probably damaging 1.00
R1984:Tg UTSW 15 66682842 missense probably benign
R2063:Tg UTSW 15 66828553 missense probably damaging 1.00
R2092:Tg UTSW 15 66849607 missense probably null 0.26
R2109:Tg UTSW 15 66729594 missense probably benign 0.02
R2128:Tg UTSW 15 66694894 missense probably benign 0.10
R2129:Tg UTSW 15 66694894 missense probably benign 0.10
R2207:Tg UTSW 15 66681939 missense probably benign 0.15
R2219:Tg UTSW 15 66681933 missense probably benign 0.03
R2228:Tg UTSW 15 66674011 missense probably damaging 0.99
R2229:Tg UTSW 15 66674011 missense probably damaging 0.99
R2259:Tg UTSW 15 66683898 missense probably benign
R2994:Tg UTSW 15 66681953 missense probably benign
R3904:Tg UTSW 15 66766162 nonsense probably null
R3946:Tg UTSW 15 66674023 missense probably damaging 1.00
R3965:Tg UTSW 15 66684190 missense probably benign
R4245:Tg UTSW 15 66696469 missense possibly damaging 0.68
R4451:Tg UTSW 15 66766147 missense probably benign 0.01
R4487:Tg UTSW 15 66671396 missense probably damaging 1.00
R4489:Tg UTSW 15 66707942 missense probably damaging 1.00
R4623:Tg UTSW 15 66735271 missense probably benign 0.23
R4659:Tg UTSW 15 66673920 missense possibly damaging 0.67
R4728:Tg UTSW 15 66682827 missense probably damaging 1.00
R4760:Tg UTSW 15 66693319 missense probably damaging 1.00
R4797:Tg UTSW 15 66758006 critical splice donor site probably null
R4944:Tg UTSW 15 66764337 missense probably damaging 1.00
R4998:Tg UTSW 15 66674050 missense probably damaging 1.00
R5009:Tg UTSW 15 66696586 missense probably benign 0.01
R5025:Tg UTSW 15 66707930 missense probably damaging 1.00
R5035:Tg UTSW 15 66681813 splice site probably null
R5049:Tg UTSW 15 66827382 nonsense probably null
R5073:Tg UTSW 15 66735252 missense probably benign 0.05
R5169:Tg UTSW 15 66678780 nonsense probably null
R5185:Tg UTSW 15 66773474 missense probably damaging 1.00
R5227:Tg UTSW 15 66759567 missense possibly damaging 0.87
R5300:Tg UTSW 15 66678855 missense probably damaging 1.00
R5334:Tg UTSW 15 66678055 missense probably damaging 1.00
R5339:Tg UTSW 15 66678093 missense probably damaging 1.00
R5402:Tg UTSW 15 66739168 missense probably damaging 0.98
R5441:Tg UTSW 15 66696520 missense possibly damaging 0.47
R5509:Tg UTSW 15 66827293 missense probably benign 0.45
R5580:Tg UTSW 15 66685300 missense possibly damaging 0.66
R5582:Tg UTSW 15 66693435 missense probably damaging 1.00
R5624:Tg UTSW 15 66838057 missense probably benign 0.11
R5686:Tg UTSW 15 66688889 missense probably benign 0.28
R6042:Tg UTSW 15 66683993 missense probably benign 0.01
R6122:Tg UTSW 15 66828457 missense probably damaging 1.00
R6146:Tg UTSW 15 66673367 splice site probably null
R6159:Tg UTSW 15 66735247 missense possibly damaging 0.71
R6223:Tg UTSW 15 66707922 missense probably benign 0.15
R6480:Tg UTSW 15 66671311 missense probably damaging 1.00
R6505:Tg UTSW 15 66759558 missense probably damaging 0.99
R6531:Tg UTSW 15 66839362 missense probably damaging 0.99
R6614:Tg UTSW 15 66735259 missense probably damaging 0.99
R6698:Tg UTSW 15 66839362 missense probably damaging 1.00
R6798:Tg UTSW 15 66678839 missense probably damaging 1.00
R6837:Tg UTSW 15 66696135 missense probably damaging 1.00
R6861:Tg UTSW 15 66688891 missense probably benign 0.00
R6888:Tg UTSW 15 66696246 missense probably damaging 0.99
R6933:Tg UTSW 15 66764309 missense possibly damaging 0.73
R6983:Tg UTSW 15 66693358 missense probably benign 0.01
R7078:Tg UTSW 15 66673543 missense probably damaging 1.00
R7244:Tg UTSW 15 66740714 missense probably damaging 1.00
R7320:Tg UTSW 15 66694784 missense possibly damaging 0.71
R7334:Tg UTSW 15 66725272 missense probably benign 0.01
R7418:Tg UTSW 15 66696583 missense probably damaging 0.99
R7485:Tg UTSW 15 66696588 missense probably benign 0.04
R7524:Tg UTSW 15 66696161 missense probably benign 0.01
R7529:Tg UTSW 15 66694768 missense probably damaging 0.99
R7540:Tg UTSW 15 66689927 missense probably benign 0.16
R7583:Tg UTSW 15 66764418 missense probably damaging 1.00
R7594:Tg UTSW 15 66729583 missense probably benign 0.20
R7667:Tg UTSW 15 66715163 missense probably damaging 0.98
R7722:Tg UTSW 15 66764309 missense possibly damaging 0.73
R7790:Tg UTSW 15 66849604 missense probably damaging 0.99
R7838:Tg UTSW 15 66693263 missense probably benign 0.00
R7890:Tg UTSW 15 66683814 missense probably damaging 1.00
R7904:Tg UTSW 15 66705279 missense probably benign 0.08
R7919:Tg UTSW 15 66684074 missense possibly damaging 0.73
R7921:Tg UTSW 15 66683793 missense probably benign 0.08
R8037:Tg UTSW 15 66688875 missense probably benign 0.00
R8038:Tg UTSW 15 66688875 missense probably benign 0.00
R8214:Tg UTSW 15 66773398 missense probably damaging 1.00
R8304:Tg UTSW 15 66693260 nonsense probably null
R8688:Tg UTSW 15 66694953 critical splice donor site probably benign
R8709:Tg UTSW 15 66681937 missense probably benign 0.08
R8714:Tg UTSW 15 66684042 missense probably damaging 0.97
R8901:Tg UTSW 15 66685335 missense probably damaging 1.00
R9023:Tg UTSW 15 66683673 missense probably damaging 1.00
R9232:Tg UTSW 15 66698461 missense probably benign 0.01
R9310:Tg UTSW 15 66827269 missense possibly damaging 0.69
R9361:Tg UTSW 15 66685397 missense possibly damaging 0.50
R9389:Tg UTSW 15 66689324 missense probably benign 0.04
T0975:Tg UTSW 15 66688863 missense probably benign 0.01
X0005:Tg UTSW 15 66688863 missense probably benign 0.01
X0065:Tg UTSW 15 66682454 missense probably damaging 1.00
X0067:Tg UTSW 15 66748743 missense probably benign 0.10
Z1177:Tg UTSW 15 66685310 missense possibly damaging 0.49
Z1177:Tg UTSW 15 66849547 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGATGAAGTAGCTGGCAAC -3'
(R):5'- GCATGTAGAATCTTCCACCCG -3'

Sequencing Primer
(F):5'- TAGCTGGCAACTGGGGG -3'
(R):5'- CGAGAGGAAAGCAGTCAGG -3'
Posted On 2021-08-02