Mutagenetix > Incidental Mutation

Incidental Mutation 'R8917:Vmn2r118'

679022

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r118

Ensembl Gene

ENSMUSG00000091504

Gene Name

vomeronasal 2, receptor 118

Synonyms

EG383258, Vmn2r119, EG668547

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R8917 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55592341-55624672 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55610216 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 432 (E432G)

Ref Sequence

ENSEMBL: ENSMUSP00000131128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168440]

AlphaFold

E9Q1C1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168440
AA Change: E432G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: E432G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	142	470	4.6e-27	PFAM
Pfam:NCD3G	513	566	2.6e-20	PFAM
Pfam:7tm_3	599	834	5.9e-55	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	G	1: 37,637,912	V63A	probably damaging	Het
2610528J11Rik	A	G	4: 118,529,293	M1V	probably null	Het
Acss3	T	C	10: 106,937,263	S621G	probably benign	Het
Adam1a	C	T	5: 121,519,082	R716Q	probably benign	Het
Ankrd26	G	T	6: 118,558,941	N177K	probably damaging	Het
Ankrd31	G	A	13: 96,832,704	V950I	probably damaging	Het
Ano4	A	G	10: 88,952,298	Y922H	probably damaging	Het
Axin2	A	T	11: 108,931,515	N298Y	probably damaging	Het
Celsr2	A	T	3: 108,396,566	M2392K	probably benign	Het
Coasy	A	G	11: 101,083,376	S123G	probably benign	Het
Ctla2a	A	T	13: 60,936,040	M26K	probably benign	Het
Cts8	A	T	13: 61,249,068		probably benign	Het
Cyp4a30b	C	A	4: 115,454,465	S110*	probably null	Het
Eif2ak4	A	G	2: 118,457,136	Y1195C	probably damaging	Het
Erh	G	T	12: 80,637,508	A65E	probably benign	Het
Exoc6	A	G	19: 37,589,912	D401G	probably benign	Het
Fmo1	A	G	1: 162,836,204	V252A	probably benign	Het
Furin	T	C	7: 80,398,689	K28E	probably benign	Het
Gm12800	G	A	4: 101,911,738	V429M	probably benign	Het
Gm9268	T	C	7: 43,048,009	I830T	probably damaging	Het
Gmip	T	A	8: 69,817,778	F713I	probably damaging	Het
Hyal6	T	C	6: 24,734,104	L12P	possibly damaging	Het
Ido1	T	C	8: 24,591,507	N144D	probably benign	Het
Igsf10	T	A	3: 59,319,467	T2262S	possibly damaging	Het
Insrr	T	C	3: 87,810,969	F923S	probably benign	Het
Kank1	G	T	19: 25,409,564	M200I	probably damaging	Het
Kctd15	A	G	7: 34,642,083	Y140H	probably damaging	Het
Kif3c	T	A	12: 3,366,690	I237N	probably damaging	Het
Klhl26	T	C	8: 70,452,805	S152G	possibly damaging	Het
Lce1k	C	A	3: 92,806,790	C29F	unknown	Het
Map1a	A	G	2: 121,301,310	E869G	possibly damaging	Het
Mcmbp	T	C	7: 128,698,557	E576G	probably benign	Het
Mrps22	A	G	9: 98,594,110	V231A	probably benign	Het
Myo1a	C	T	10: 127,715,665	L697F	possibly damaging	Het
Ncapd3	T	C	9: 27,088,001	V1291A	probably benign	Het
Olfr1154	A	T	2: 87,902,963	S238T	possibly damaging	Het
Pcdhb6	A	G	18: 37,335,378	T451A	possibly damaging	Het
Pdzd3	T	A	9: 44,248,844		probably benign	Het
Pi4ka	C	A	16: 17,312,446	W1032L		Het
Pkhd1l1	T	A	15: 44,533,007	I1975N	probably benign	Het
Pnpla6	T	C	8: 3,517,637	M115T	possibly damaging	Het
Poldip2	G	A	11: 78,521,841	R347Q	probably damaging	Het
Rapgef6	C	T	11: 54,691,566	Q1440*	probably null	Het
Rtn3	A	T	19: 7,456,740	I629K	possibly damaging	Het
Selenov	A	G	7: 28,288,303	F278L	probably damaging	Het
Skor2	G	A	18: 76,860,809	G742D	probably damaging	Het
Spata31d1c	C	T	13: 65,035,615	P324S	probably benign	Het
Tbc1d14	A	T	5: 36,519,338	I403N	probably damaging	Het
Tekt3	A	T	11: 63,087,226	Q374L	probably damaging	Het
Tg	T	C	15: 66,773,483		probably null	Het
Thnsl2	T	C	6: 71,139,943	D75G	probably benign	Het
Tnr	A	T	1: 159,874,122	K598*	probably null	Het
Tshr	T	A	12: 91,502,055		probably benign	Het
Uggt1	A	G	1: 36,146,654	S1483P		Het
Usp42	T	C	5: 143,715,940	E776G		Het
Zfhx4	A	G	3: 5,399,099	E1464G	probably damaging	Het
Zfp518a	A	C	19: 40,913,426	K600Q	possibly damaging	Het
Zxdc	A	G	6: 90,382,323	T646A	probably benign	Het

Other mutations in Vmn2r118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Vmn2r118	APN	17	55592708	missense	probably damaging	1.00
IGL00976:Vmn2r118	APN	17	55593204	missense	probably damaging	1.00
IGL01419:Vmn2r118	APN	17	55593000	missense	probably benign	0.01
IGL01796:Vmn2r118	APN	17	55608585	missense	probably benign	0.30
IGL01799:Vmn2r118	APN	17	55592990	missense	probably damaging	1.00
IGL02002:Vmn2r118	APN	17	55592619	missense	probably damaging	1.00
IGL02075:Vmn2r118	APN	17	55610517	missense	probably benign	0.18
IGL02172:Vmn2r118	APN	17	55624598	missense	probably benign	0.00
IGL02529:Vmn2r118	APN	17	55610870	missense	possibly damaging	0.58
IGL02712:Vmn2r118	APN	17	55592655	missense	probably benign	0.21
IGL03096:Vmn2r118	APN	17	55607996	missense	probably damaging	1.00
R0306:Vmn2r118	UTSW	17	55608616	missense	possibly damaging	0.89
R0329:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0330:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0396:Vmn2r118	UTSW	17	55608643	missense	probably benign	0.00
R0411:Vmn2r118	UTSW	17	55611021	splice site	probably benign
R0513:Vmn2r118	UTSW	17	55610970	nonsense	probably null
R0627:Vmn2r118	UTSW	17	55610772	missense	probably benign	0.01
R0638:Vmn2r118	UTSW	17	55608466	missense	probably benign	0.03
R1328:Vmn2r118	UTSW	17	55608620	missense	probably benign	0.01
R1366:Vmn2r118	UTSW	17	55593237	nonsense	probably null
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1511:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R1515:Vmn2r118	UTSW	17	55610643	missense	probably benign	0.25
R1550:Vmn2r118	UTSW	17	55608083	missense	probably damaging	1.00
R1779:Vmn2r118	UTSW	17	55611530	missense	probably benign	0.03
R1834:Vmn2r118	UTSW	17	55592456	missense	probably damaging	1.00
R1840:Vmn2r118	UTSW	17	55610406	nonsense	probably null
R1854:Vmn2r118	UTSW	17	55611556	missense	possibly damaging	0.57
R1967:Vmn2r118	UTSW	17	55592882	missense	probably damaging	1.00
R1976:Vmn2r118	UTSW	17	55592925	missense	probably damaging	1.00
R2308:Vmn2r118	UTSW	17	55624650	missense	probably benign	0.33
R3700:Vmn2r118	UTSW	17	55608421	missense	possibly damaging	0.68
R4334:Vmn2r118	UTSW	17	55610347	missense	possibly damaging	0.58
R4647:Vmn2r118	UTSW	17	55610665	missense	probably damaging	1.00
R4709:Vmn2r118	UTSW	17	55610860	missense	probably damaging	1.00
R4805:Vmn2r118	UTSW	17	55592581	missense	probably damaging	1.00
R4858:Vmn2r118	UTSW	17	55592894	missense	probably damaging	0.98
R5384:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5385:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5664:Vmn2r118	UTSW	17	55592765	missense	possibly damaging	0.46
R5740:Vmn2r118	UTSW	17	55593103	missense	probably benign	0.00
R5927:Vmn2r118	UTSW	17	55624494	missense	probably benign	0.04
R6143:Vmn2r118	UTSW	17	55592871	missense	possibly damaging	0.92
R6513:Vmn2r118	UTSW	17	55608093	missense	probably damaging	1.00
R6573:Vmn2r118	UTSW	17	55592996	missense	probably damaging	1.00
R6760:Vmn2r118	UTSW	17	55592714	missense	possibly damaging	0.92
R6794:Vmn2r118	UTSW	17	55592348	missense	possibly damaging	0.48
R6929:Vmn2r118	UTSW	17	55610440	missense	probably benign	0.01
R7201:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R7539:Vmn2r118	UTSW	17	55592853	missense	probably damaging	0.98
R7836:Vmn2r118	UTSW	17	55593242	missense	probably damaging	0.99
R8179:Vmn2r118	UTSW	17	55608484	missense	probably benign	0.36
R8248:Vmn2r118	UTSW	17	55610936	missense	probably benign	0.18
R8347:Vmn2r118	UTSW	17	55610423	missense	possibly damaging	0.94
R8415:Vmn2r118	UTSW	17	55608057	missense	probably benign	0.08
R8428:Vmn2r118	UTSW	17	55608642	missense	probably benign	0.33
R8993:Vmn2r118	UTSW	17	55610835	missense	possibly damaging	0.72
R9038:Vmn2r118	UTSW	17	55611649	missense	probably damaging	1.00
R9155:Vmn2r118	UTSW	17	55610207	missense	probably null	0.83
R9603:Vmn2r118	UTSW	17	55592837	missense	probably damaging	1.00
R9742:Vmn2r118	UTSW	17	55611009	missense	probably damaging	0.98
R9749:Vmn2r118	UTSW	17	55608415	critical splice donor site	probably null
R9792:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
R9793:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
R9795:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
X0022:Vmn2r118	UTSW	17	55593218	missense	probably damaging	1.00
Z1176:Vmn2r118	UTSW	17	55610655	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCTCATAAAGGCAAAGGGG -3'
(R):5'- GCACATCCAGCAACTTATTGGAATG -3'

Sequencing Primer
(F):5'- TGGGGGAGTTGGAGAGGTAAC -3'
(R):5'- CTTATTGGAATGGTTACCACGGCAC -3'

Posted On

2021-08-02