Incidental Mutation 'R8918:Acacb'
ID 679049
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 068705-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8918 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114333315 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 480 (F480L)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582] [ENSMUST00000146841]
AlphaFold E9Q4Z2
Predicted Effect probably damaging
Transcript: ENSMUST00000031583
AA Change: F480L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: F480L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102582
AA Change: F480L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: F480L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146841
SMART Domains Protein: ENSMUSP00000115432
Gene: ENSMUSG00000042010

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 57 146 6.4e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 A T 10: 89,553,057 (GRCm39) I267N probably damaging Het
Ank2 A G 3: 126,737,380 (GRCm39) S2835P unknown Het
Arfgef3 C T 10: 18,511,453 (GRCm39) R753Q probably benign Het
Arid3a A G 10: 79,784,765 (GRCm39) T285A probably benign Het
Atad5 T C 11: 79,986,473 (GRCm39) V520A probably benign Het
Atoh1 T G 6: 64,707,241 (GRCm39) L312R probably damaging Het
Brd10 T C 19: 29,696,841 (GRCm39) K884R possibly damaging Het
Cpt1a T C 19: 3,408,258 (GRCm39) V179A Het
Crocc2 C A 1: 93,129,144 (GRCm39) N816K possibly damaging Het
Csf2ra A T 19: 61,214,721 (GRCm39) V201D probably damaging Het
Dok1 C T 6: 83,008,324 (GRCm39) V453I probably benign Het
Elp4 A G 2: 105,662,600 (GRCm39) S175P probably benign Het
Erh G T 12: 80,684,282 (GRCm39) A65E probably benign Het
Etl4 G A 2: 20,748,733 (GRCm39) S357N probably benign Het
Etl4 A G 2: 20,811,246 (GRCm39) T1478A probably benign Het
Gabra1 A G 11: 42,026,320 (GRCm39) F324S probably damaging Het
Gm11437 T C 11: 84,043,530 (GRCm39) T254A probably benign Het
Gria2 T C 3: 80,599,706 (GRCm39) E726G probably damaging Het
Gstm2 A T 3: 107,892,382 (GRCm39) C115S possibly damaging Het
Ighv1-12 T C 12: 114,579,553 (GRCm39) T90A probably damaging Het
Inf2 A G 12: 112,572,703 (GRCm39) I690V unknown Het
Kdm3b A G 18: 34,970,650 (GRCm39) N1739S probably damaging Het
Lrp1b A T 2: 40,615,893 (GRCm39) N3614K Het
Mapk8ip3 A G 17: 25,131,727 (GRCm39) L404P probably damaging Het
Mcl1 T C 3: 95,567,192 (GRCm39) F251S probably damaging Het
Mdn1 T A 4: 32,744,579 (GRCm39) L4038* probably null Het
Mmp8 T C 9: 7,561,485 (GRCm39) V163A probably benign Het
Myo18b C T 5: 113,022,873 (GRCm39) probably benign Het
Ndst1 C T 18: 60,825,083 (GRCm39) R745H probably benign Het
Or4d2b A G 11: 87,780,284 (GRCm39) V146A probably benign Het
Or8c18 T C 9: 38,203,385 (GRCm39) F48S probably benign Het
Pard3 C T 8: 128,098,011 (GRCm39) R351C probably benign Het
Pcdhgb4 A G 18: 37,855,648 (GRCm39) D681G probably damaging Het
Pde10a G A 17: 9,160,063 (GRCm39) A163T possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pelp1 A G 11: 70,296,505 (GRCm39) L123S probably damaging Het
Plekhh2 A G 17: 84,906,621 (GRCm39) D1152G possibly damaging Het
Rag1 T C 2: 101,472,098 (GRCm39) T1015A probably benign Het
Rock2 C T 12: 16,990,422 (GRCm39) Q115* probably null Het
Rorb T A 19: 18,915,356 (GRCm39) H434L probably damaging Het
Safb2 A T 17: 56,882,975 (GRCm39) C219* probably null Het
Sema3a A G 5: 13,573,099 (GRCm39) H209R probably damaging Het
Serpinb9g T G 13: 33,679,131 (GRCm39) S334A probably benign Het
Slc5a9 T A 4: 111,741,147 (GRCm39) M500L probably benign Het
Snap91 A G 9: 86,651,611 (GRCm39) S810P unknown Het
Spink5 G T 18: 44,100,087 (GRCm39) A35S probably damaging Het
Stxbp5l G A 16: 36,954,892 (GRCm39) T887I Het
Tacc2 T C 7: 130,227,823 (GRCm39) F1503L probably benign Het
Tectb A G 19: 55,180,000 (GRCm39) E272G probably damaging Het
Trdn A T 10: 33,015,117 (GRCm39) I24F probably benign Het
Tshr G A 12: 91,504,211 (GRCm39) S383N probably benign Het
Tspan1 C A 4: 116,020,970 (GRCm39) C149F probably damaging Het
Ttn A T 2: 76,570,862 (GRCm39) L26677Q probably damaging Het
Ush2a T A 1: 188,270,017 (GRCm39) F1755I possibly damaging Het
Vps13d T A 4: 144,772,873 (GRCm39) I4047F Het
Zfp1010 A C 2: 176,958,551 (GRCm39) S29R probably benign Het
Zfp369 T A 13: 65,443,529 (GRCm39) L336* probably null Het
Zfp518a A C 19: 40,901,870 (GRCm39) K600Q possibly damaging Het
Zfp984 T C 4: 147,840,623 (GRCm39) H76R possibly damaging Het
Zscan10 G A 17: 23,826,116 (GRCm39) G138S probably benign Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACTAAGGAAATGGTGCCCTG -3'
(R):5'- TGAACTCAAACACGGCAGGC -3'

Sequencing Primer
(F):5'- GAAAGCATACCACGTGTCTGTTG -3'
(R):5'- TCTGAATGGAACAGTCCC -3'
Posted On 2021-08-02