Incidental Mutation 'R8918:Pde10a'
ID679075
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Namephosphodiesterase 10A
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8918 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location8525372-8986648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8941231 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 163 (A163T)
Ref Sequence ENSEMBL: ENSMUSP00000086485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
Predicted Effect probably damaging
Transcript: ENSMUST00000024647
AA Change: A83T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: A83T

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000089085
AA Change: A163T

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: A163T

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115708
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115715
AA Change: A83T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: A83T

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
AA Change: C146Y

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect possibly damaging
Transcript: ENSMUST00000115720
AA Change: A146T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: A146T

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115724
AA Change: A217T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: A217T

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149440
AA Change: A94T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: A94T

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231430
AA Change: A445T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,719,441 K884R possibly damaging Het
Acacb T C 5: 114,195,254 F480L probably damaging Het
Actr6 A T 10: 89,717,195 I267N probably damaging Het
Ank2 A G 3: 126,943,731 S2835P unknown Het
Arfgef3 C T 10: 18,635,705 R753Q probably benign Het
Arid3a A G 10: 79,948,931 T285A probably benign Het
Atad5 T C 11: 80,095,647 V520A probably benign Het
Atoh1 T G 6: 64,730,257 L312R probably damaging Het
Cpt1a T C 19: 3,358,258 V179A Het
Crocc2 C A 1: 93,201,422 N816K possibly damaging Het
Csf2ra A T 19: 61,226,283 V201D probably damaging Het
Dok1 C T 6: 83,031,343 V453I probably benign Het
Elp4 A G 2: 105,832,255 S175P probably benign Het
Erh G T 12: 80,637,508 A65E probably benign Het
Etl4 G A 2: 20,743,922 S357N probably benign Het
Etl4 A G 2: 20,806,435 T1478A probably benign Het
Gabra1 A G 11: 42,135,493 F324S probably damaging Het
Gm11437 T C 11: 84,152,704 T254A probably benign Het
Gm14409 A C 2: 177,266,758 S29R probably benign Het
Gria2 T C 3: 80,692,399 E726G probably damaging Het
Gstm2 A T 3: 107,985,066 C115S possibly damaging Het
Ighv1-12 T C 12: 114,615,933 T90A probably damaging Het
Inf2 A G 12: 112,606,269 I690V unknown Het
Kdm3b A G 18: 34,837,597 N1739S probably damaging Het
Lrp1b A T 2: 40,725,881 N3614K Het
Mapk8ip3 A G 17: 24,912,753 L404P probably damaging Het
Mcl1 T C 3: 95,659,881 F251S probably damaging Het
Mdn1 T A 4: 32,744,579 L4038* probably null Het
Mmp8 T C 9: 7,561,484 V163A probably benign Het
Myo18b C T 5: 112,875,007 probably benign Het
Ndst1 C T 18: 60,692,011 R745H probably benign Het
Olfr462 A G 11: 87,889,458 V146A probably benign Het
Olfr896-ps1 T C 9: 38,292,089 F48S probably benign Het
Pard3 C T 8: 127,371,530 R351C probably benign Het
Pcdhgb4 A G 18: 37,722,595 D681G probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pelp1 A G 11: 70,405,679 L123S probably damaging Het
Plekhh2 A G 17: 84,599,193 D1152G possibly damaging Het
Rag1 T C 2: 101,641,753 T1015A probably benign Het
Rock2 C T 12: 16,940,421 Q115* probably null Het
Rorb T A 19: 18,937,992 H434L probably damaging Het
Safb2 A T 17: 56,575,975 C219* probably null Het
Sema3a A G 5: 13,523,132 H209R probably damaging Het
Serpinb9g T G 13: 33,495,148 S334A probably benign Het
Slc5a9 T A 4: 111,883,950 M500L probably benign Het
Snap91 A G 9: 86,769,558 S810P unknown Het
Spink5 G T 18: 43,967,020 A35S probably damaging Het
Stxbp5l G A 16: 37,134,530 T887I Het
Tacc2 T C 7: 130,626,093 F1503L probably benign Het
Tectb A G 19: 55,191,568 E272G probably damaging Het
Trdn A T 10: 33,139,121 I24F probably benign Het
Tshr G A 12: 91,537,437 S383N probably benign Het
Tspan1 C A 4: 116,163,773 C149F probably damaging Het
Ttn A T 2: 76,740,518 L26677Q probably damaging Het
Ush2a T A 1: 188,537,820 F1755I possibly damaging Het
Vps13d T A 4: 145,046,303 I4047F Het
Zfp369 T A 13: 65,295,715 L336* probably null Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Zfp984 T C 4: 147,756,166 H76R possibly damaging Het
Zscan10 G A 17: 23,607,142 G138S probably benign Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
brautigam UTSW 17 8964677 missense possibly damaging 0.78
Bride UTSW 17 8949430 missense possibly damaging 0.60
buzzed UTSW 17 8930537 missense probably damaging 1.00
Gracile UTSW 17 8961920 missense possibly damaging 0.63
Nubile UTSW 17 8967462 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
R7833:Pde10a UTSW 17 8961920 missense possibly damaging 0.63
R7923:Pde10a UTSW 17 8929132 missense probably benign 0.40
R8053:Pde10a UTSW 17 8974772 missense probably benign 0.12
R8137:Pde10a UTSW 17 8974815 missense possibly damaging 0.90
R8722:Pde10a UTSW 17 8944940 missense probably benign 0.01
R8973:Pde10a UTSW 17 8924239 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGATCTAGTTAGGTAATGCCC -3'
(R):5'- ATTTCCCAGGGAGCACCATG -3'

Sequencing Primer
(F):5'- GCCCTAGAGTCTTACTGATATTAGGC -3'
(R):5'- AGAAGGTTAAACTCTAAGCCAATTC -3'
Posted On2021-08-02