Incidental Mutation 'R8918:Spink5'
ID 679082
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Name serine peptidase inhibitor, Kazal type 5
Synonyms 2310065D10Rik, LEKT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8918 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 43963235-44022501 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 43967020 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 35 (A35S)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
AlphaFold Q148R4
Predicted Effect probably damaging
Transcript: ENSMUST00000069245
AA Change: A35S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: A35S

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,719,441 K884R possibly damaging Het
Acacb T C 5: 114,195,254 F480L probably damaging Het
Actr6 A T 10: 89,717,195 I267N probably damaging Het
Ank2 A G 3: 126,943,731 S2835P unknown Het
Arfgef3 C T 10: 18,635,705 R753Q probably benign Het
Arid3a A G 10: 79,948,931 T285A probably benign Het
Atad5 T C 11: 80,095,647 V520A probably benign Het
Atoh1 T G 6: 64,730,257 L312R probably damaging Het
Cpt1a T C 19: 3,358,258 V179A Het
Crocc2 C A 1: 93,201,422 N816K possibly damaging Het
Csf2ra A T 19: 61,226,283 V201D probably damaging Het
Dok1 C T 6: 83,031,343 V453I probably benign Het
Elp4 A G 2: 105,832,255 S175P probably benign Het
Erh G T 12: 80,637,508 A65E probably benign Het
Etl4 G A 2: 20,743,922 S357N probably benign Het
Etl4 A G 2: 20,806,435 T1478A probably benign Het
Gabra1 A G 11: 42,135,493 F324S probably damaging Het
Gm11437 T C 11: 84,152,704 T254A probably benign Het
Gm14409 A C 2: 177,266,758 S29R probably benign Het
Gria2 T C 3: 80,692,399 E726G probably damaging Het
Gstm2 A T 3: 107,985,066 C115S possibly damaging Het
Ighv1-12 T C 12: 114,615,933 T90A probably damaging Het
Inf2 A G 12: 112,606,269 I690V unknown Het
Kdm3b A G 18: 34,837,597 N1739S probably damaging Het
Lrp1b A T 2: 40,725,881 N3614K Het
Mapk8ip3 A G 17: 24,912,753 L404P probably damaging Het
Mcl1 T C 3: 95,659,881 F251S probably damaging Het
Mdn1 T A 4: 32,744,579 L4038* probably null Het
Mmp8 T C 9: 7,561,484 V163A probably benign Het
Myo18b C T 5: 112,875,007 probably benign Het
Ndst1 C T 18: 60,692,011 R745H probably benign Het
Olfr462 A G 11: 87,889,458 V146A probably benign Het
Olfr896-ps1 T C 9: 38,292,089 F48S probably benign Het
Pard3 C T 8: 127,371,530 R351C probably benign Het
Pcdhgb4 A G 18: 37,722,595 D681G probably damaging Het
Pde10a G A 17: 8,941,231 A163T possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pelp1 A G 11: 70,405,679 L123S probably damaging Het
Plekhh2 A G 17: 84,599,193 D1152G possibly damaging Het
Rag1 T C 2: 101,641,753 T1015A probably benign Het
Rock2 C T 12: 16,940,421 Q115* probably null Het
Rorb T A 19: 18,937,992 H434L probably damaging Het
Safb2 A T 17: 56,575,975 C219* probably null Het
Sema3a A G 5: 13,523,132 H209R probably damaging Het
Serpinb9g T G 13: 33,495,148 S334A probably benign Het
Slc5a9 T A 4: 111,883,950 M500L probably benign Het
Snap91 A G 9: 86,769,558 S810P unknown Het
Stxbp5l G A 16: 37,134,530 T887I Het
Tacc2 T C 7: 130,626,093 F1503L probably benign Het
Tectb A G 19: 55,191,568 E272G probably damaging Het
Trdn A T 10: 33,139,121 I24F probably benign Het
Tshr G A 12: 91,537,437 S383N probably benign Het
Tspan1 C A 4: 116,163,773 C149F probably damaging Het
Ttn A T 2: 76,740,518 L26677Q probably damaging Het
Ush2a T A 1: 188,537,820 F1755I possibly damaging Het
Vps13d T A 4: 145,046,303 I4047F Het
Zfp369 T A 13: 65,295,715 L336* probably null Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Zfp984 T C 4: 147,756,166 H76R possibly damaging Het
Zscan10 G A 17: 23,607,142 G138S probably benign Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
R7332:Spink5 UTSW 18 43982250 missense probably damaging 0.96
R7396:Spink5 UTSW 18 43977655 missense possibly damaging 0.95
R7643:Spink5 UTSW 18 44010252 missense probably benign 0.37
R7726:Spink5 UTSW 18 43963352 missense probably damaging 1.00
R7828:Spink5 UTSW 18 44010229 missense probably benign 0.15
R7836:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7880:Spink5 UTSW 18 43986326 missense probably benign 0.40
R8031:Spink5 UTSW 18 44010236 missense probably benign 0.07
R8198:Spink5 UTSW 18 43992880 missense probably benign 0.17
R8361:Spink5 UTSW 18 43989462 missense probably damaging 1.00
R8375:Spink5 UTSW 18 43990719 missense probably benign 0.01
R8684:Spink5 UTSW 18 44010238 missense probably benign 0.02
R8749:Spink5 UTSW 18 43989358 nonsense probably null
R9064:Spink5 UTSW 18 43967126 missense probably damaging 1.00
R9161:Spink5 UTSW 18 44014919 missense probably damaging 1.00
R9221:Spink5 UTSW 18 43986300 missense probably damaging 1.00
R9292:Spink5 UTSW 18 44015008 missense possibly damaging 0.91
R9545:Spink5 UTSW 18 44003195 missense possibly damaging 0.88
Z1177:Spink5 UTSW 18 43996635 missense probably damaging 0.97
Z1177:Spink5 UTSW 18 43996697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCATCAAGGATCCTTTGTCTCC -3'
(R):5'- TTCCCAATGCTCCAGAGACG -3'

Sequencing Primer
(F):5'- AAGGATCCTTTGTCTCCCTCCATAC -3'
(R):5'- CTCCAGAGACGAGGCAGTTG -3'
Posted On 2021-08-02