Incidental Mutation 'R8918:Ndst1'
ID 679083
Institutional Source Beutler Lab
Gene Symbol Ndst1
Ensembl Gene ENSMUSG00000054008
Gene Name N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonyms glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8918 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 60685978-60713389 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 60692011 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 745 (R745H)
Ref Sequence ENSEMBL: ENSMUSP00000126623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169273]
AlphaFold Q3UHN9
Predicted Effect probably benign
Transcript: ENSMUST00000169273
AA Change: R745H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: R745H

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:HSNSD 25 515 5.1e-254 PFAM
Pfam:Sulfotransfer_1 604 869 2.2e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,719,441 K884R possibly damaging Het
Acacb T C 5: 114,195,254 F480L probably damaging Het
Actr6 A T 10: 89,717,195 I267N probably damaging Het
Ank2 A G 3: 126,943,731 S2835P unknown Het
Arfgef3 C T 10: 18,635,705 R753Q probably benign Het
Arid3a A G 10: 79,948,931 T285A probably benign Het
Atad5 T C 11: 80,095,647 V520A probably benign Het
Atoh1 T G 6: 64,730,257 L312R probably damaging Het
Cpt1a T C 19: 3,358,258 V179A Het
Crocc2 C A 1: 93,201,422 N816K possibly damaging Het
Csf2ra A T 19: 61,226,283 V201D probably damaging Het
Dok1 C T 6: 83,031,343 V453I probably benign Het
Elp4 A G 2: 105,832,255 S175P probably benign Het
Erh G T 12: 80,637,508 A65E probably benign Het
Etl4 G A 2: 20,743,922 S357N probably benign Het
Etl4 A G 2: 20,806,435 T1478A probably benign Het
Gabra1 A G 11: 42,135,493 F324S probably damaging Het
Gm11437 T C 11: 84,152,704 T254A probably benign Het
Gm14409 A C 2: 177,266,758 S29R probably benign Het
Gria2 T C 3: 80,692,399 E726G probably damaging Het
Gstm2 A T 3: 107,985,066 C115S possibly damaging Het
Ighv1-12 T C 12: 114,615,933 T90A probably damaging Het
Inf2 A G 12: 112,606,269 I690V unknown Het
Kdm3b A G 18: 34,837,597 N1739S probably damaging Het
Lrp1b A T 2: 40,725,881 N3614K Het
Mapk8ip3 A G 17: 24,912,753 L404P probably damaging Het
Mcl1 T C 3: 95,659,881 F251S probably damaging Het
Mdn1 T A 4: 32,744,579 L4038* probably null Het
Mmp8 T C 9: 7,561,484 V163A probably benign Het
Myo18b C T 5: 112,875,007 probably benign Het
Olfr462 A G 11: 87,889,458 V146A probably benign Het
Olfr896-ps1 T C 9: 38,292,089 F48S probably benign Het
Pard3 C T 8: 127,371,530 R351C probably benign Het
Pcdhgb4 A G 18: 37,722,595 D681G probably damaging Het
Pde10a G A 17: 8,941,231 A163T possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pelp1 A G 11: 70,405,679 L123S probably damaging Het
Plekhh2 A G 17: 84,599,193 D1152G possibly damaging Het
Rag1 T C 2: 101,641,753 T1015A probably benign Het
Rock2 C T 12: 16,940,421 Q115* probably null Het
Rorb T A 19: 18,937,992 H434L probably damaging Het
Safb2 A T 17: 56,575,975 C219* probably null Het
Sema3a A G 5: 13,523,132 H209R probably damaging Het
Serpinb9g T G 13: 33,495,148 S334A probably benign Het
Slc5a9 T A 4: 111,883,950 M500L probably benign Het
Snap91 A G 9: 86,769,558 S810P unknown Het
Spink5 G T 18: 43,967,020 A35S probably damaging Het
Stxbp5l G A 16: 37,134,530 T887I Het
Tacc2 T C 7: 130,626,093 F1503L probably benign Het
Tectb A G 19: 55,191,568 E272G probably damaging Het
Trdn A T 10: 33,139,121 I24F probably benign Het
Tshr G A 12: 91,537,437 S383N probably benign Het
Tspan1 C A 4: 116,163,773 C149F probably damaging Het
Ttn A T 2: 76,740,518 L26677Q probably damaging Het
Ush2a T A 1: 188,537,820 F1755I possibly damaging Het
Vps13d T A 4: 145,046,303 I4047F Het
Zfp369 T A 13: 65,295,715 L336* probably null Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Zfp984 T C 4: 147,756,166 H76R possibly damaging Het
Zscan10 G A 17: 23,607,142 G138S probably benign Het
Other mutations in Ndst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ndst1 APN 18 60707956 missense probably damaging 1.00
IGL01410:Ndst1 APN 18 60700445 missense probably damaging 1.00
IGL01578:Ndst1 APN 18 60713126 missense probably damaging 1.00
IGL02133:Ndst1 APN 18 60699546 missense probably benign 0.05
IGL03200:Ndst1 APN 18 60699539 missense possibly damaging 0.86
R0631:Ndst1 UTSW 18 60700359 splice site probably benign
R0899:Ndst1 UTSW 18 60707882 missense probably benign 0.00
R1104:Ndst1 UTSW 18 60697146 missense probably damaging 0.98
R1371:Ndst1 UTSW 18 60707647 missense possibly damaging 0.90
R1456:Ndst1 UTSW 18 60713205 missense possibly damaging 0.73
R1511:Ndst1 UTSW 18 60697170 missense possibly damaging 0.61
R1524:Ndst1 UTSW 18 60698504 missense probably damaging 0.99
R1699:Ndst1 UTSW 18 60695508 missense probably damaging 1.00
R1718:Ndst1 UTSW 18 60707803 missense probably damaging 0.99
R1772:Ndst1 UTSW 18 60702837 missense probably damaging 0.99
R1900:Ndst1 UTSW 18 60712721 critical splice donor site probably null
R2079:Ndst1 UTSW 18 60695509 missense probably damaging 1.00
R2105:Ndst1 UTSW 18 60691253 missense probably benign 0.01
R2127:Ndst1 UTSW 18 60691208 missense probably benign 0.00
R2875:Ndst1 UTSW 18 60690047 missense probably damaging 1.00
R3798:Ndst1 UTSW 18 60713166 missense possibly damaging 0.94
R3950:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3951:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3952:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R4868:Ndst1 UTSW 18 60695476 missense probably benign 0.07
R4898:Ndst1 UTSW 18 60691987 missense probably benign 0.12
R4988:Ndst1 UTSW 18 60702933 missense probably damaging 0.99
R5271:Ndst1 UTSW 18 60705132 missense probably benign 0.03
R5337:Ndst1 UTSW 18 60690007 missense probably damaging 1.00
R5467:Ndst1 UTSW 18 60692021 missense probably benign
R5830:Ndst1 UTSW 18 60703838 missense probably damaging 1.00
R5968:Ndst1 UTSW 18 60713076 missense probably benign
R6241:Ndst1 UTSW 18 60703829 missense probably damaging 0.99
R6422:Ndst1 UTSW 18 60702953 missense probably benign 0.44
R7099:Ndst1 UTSW 18 60695500 missense possibly damaging 0.88
R7544:Ndst1 UTSW 18 60697184 missense probably damaging 1.00
R8951:Ndst1 UTSW 18 60697124 missense probably benign
R9187:Ndst1 UTSW 18 60691196 missense probably benign 0.03
R9374:Ndst1 UTSW 18 60712859 missense probably damaging 0.97
V8831:Ndst1 UTSW 18 60702927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGATCTAACCCTGCCAACC -3'
(R):5'- TCCCTGAGGCTAAAGCAGTG -3'

Sequencing Primer
(F):5'- TCCAATCAGGCTCAGGCTCAG -3'
(R):5'- CCTGAGGCTAAAGCAGTGAGAGG -3'
Posted On 2021-08-02