Incidental Mutation 'R8919:Tulp3'
ID 679120
Institutional Source Beutler Lab
Gene Symbol Tulp3
Ensembl Gene ENSMUSG00000001521
Gene Name tubby-like protein 3
Synonyms 2310022L06Rik
MMRRC Submission 068706-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8919 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 128298124-128332814 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128310966 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 87 (D87G)
Ref Sequence ENSEMBL: ENSMUSP00000001562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001562] [ENSMUST00000133134]
AlphaFold O88413
Predicted Effect probably benign
Transcript: ENSMUST00000001562
AA Change: D87G

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000001562
Gene: ENSMUSG00000001521
AA Change: D87G

DomainStartEndE-ValueType
Pfam:Tub_N 30 84 1.7e-23 PFAM
Pfam:Tub_N 76 198 5.5e-16 PFAM
Pfam:Tub 213 454 1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133134
SMART Domains Protein: ENSMUSP00000145180
Gene: ENSMUSG00000001521

DomainStartEndE-ValueType
Pfam:Tub_N 35 76 2.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubby gene family of bipartite transcription factors. Members of this family have been identified in plants, vertebrates, and invertebrates, and they share a conserved N-terminal transcription activation region and a conserved C-terminal DNA and phosphatidylinositol-phosphate binding region. The encoded protein binds to phosphoinositides in the plasma membrane via its C-terminal region and probably functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis, for instance, induced by G-protein-coupled-receptor signaling. It plays an important role in neuronal development and function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mutant mice exhibit failed neural tube closure followed by neuroepithelial apoptosis and ultimately embryonic death around E14.5. Heterozygotes are largely phenotypically normal, however some exhibit neuroepithelial apoptosis and die as embryos. [provided by MGI curators]
Allele List at MGI

All alleles(35) : Targeted, other(3) Gene trapped(31) Chemically induced(1)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat C T 8: 60,993,158 (GRCm39) T373I possibly damaging Het
Abca13 T C 11: 9,241,653 (GRCm39) L1172P possibly damaging Het
Abcg2 A G 6: 58,661,326 (GRCm39) Y459C probably benign Het
AC125199.3 T C 16: 88,609,061 (GRCm39) N4D possibly damaging Het
Acad8 A G 9: 26,910,785 (GRCm39) M3T probably benign Het
Acsbg3 A C 17: 57,189,218 (GRCm39) I209L probably benign Het
Adcyap1r1 C T 6: 55,474,080 (GRCm39) T472I probably damaging Het
Ank3 A T 10: 69,840,671 (GRCm39) K1890N possibly damaging Het
Asic1 G A 15: 99,569,826 (GRCm39) C49Y probably benign Het
Atp1a1 T C 3: 101,498,547 (GRCm39) N215S probably damaging Het
C87436 A G 6: 86,422,774 (GRCm39) Y116C probably damaging Het
Car5a T C 8: 122,671,519 (GRCm39) D5G probably benign Het
Ccdc169 T C 3: 55,058,368 (GRCm39) probably null Het
Ccdc93 A G 1: 121,426,970 (GRCm39) R586G probably damaging Het
Cep295 A G 9: 15,238,007 (GRCm39) V131A probably damaging Het
Cox5a A G 9: 57,436,329 (GRCm39) D60G possibly damaging Het
Cpne6 A T 14: 55,750,104 (GRCm39) E78D probably benign Het
Cyp2u1 T C 3: 131,089,114 (GRCm39) E390G probably damaging Het
Dab2 C A 15: 6,465,271 (GRCm39) N707K Het
Dock10 A T 1: 80,483,147 (GRCm39) D2101E probably benign Het
Duoxa2 G A 2: 122,132,357 (GRCm39) probably null Het
Eif4a3 T C 11: 119,190,758 (GRCm39) D22G probably benign Het
Fhip1b T C 7: 105,037,477 (GRCm39) T369A possibly damaging Het
Fubp3 A G 2: 31,482,476 (GRCm39) probably null Het
Gm10330 A G 12: 23,829,887 (GRCm39) L98P probably benign Het
Gm5108 A G 5: 68,134,299 (GRCm39) *102W probably null Het
Gpr149 A C 3: 62,438,478 (GRCm39) S560A probably damaging Het
Haspin T C 11: 73,027,430 (GRCm39) D553G probably benign Het
Hsf1 C T 15: 76,382,051 (GRCm39) H104Y probably benign Het
Ifi203 T C 1: 173,756,494 (GRCm39) T430A unknown Het
Itih2 G A 2: 10,102,822 (GRCm39) Q771* probably null Het
Kazald1 T A 19: 45,065,395 (GRCm39) L92Q probably damaging Het
Krt19 T C 11: 100,031,980 (GRCm39) E324G probably damaging Het
Lrrc28 A T 7: 67,268,833 (GRCm39) V79E possibly damaging Het
Ltn1 T A 16: 87,178,381 (GRCm39) Q1616L probably damaging Het
Mdc1 A G 17: 36,158,843 (GRCm39) K408E probably benign Het
Nalcn A T 14: 123,561,284 (GRCm39) M738K probably benign Het
Ncoa4 T C 14: 31,894,848 (GRCm39) L125P probably damaging Het
Ncor2 G T 5: 125,106,253 (GRCm39) R810S Het
Neb C T 2: 52,127,141 (GRCm39) G348D Het
Nfat5 T A 8: 108,095,228 (GRCm39) F1156L probably damaging Het
Oit3 G A 10: 59,277,468 (GRCm39) T13I unknown Het
Opa1 A C 16: 29,424,340 (GRCm39) Q230P probably damaging Het
Or10j3b T C 1: 173,044,064 (GRCm39) I282T probably damaging Het
Or52k2 T A 7: 102,253,711 (GRCm39) I50N probably damaging Het
Or5p66 A G 7: 107,886,289 (GRCm39) F15L probably damaging Het
Or5w12 A C 2: 87,502,567 (GRCm39) L48W probably damaging Het
Or6c5b G T 10: 129,246,082 (GRCm39) M282I probably benign Het
Parpbp T C 10: 87,946,189 (GRCm39) H410R probably null Het
Pex5l A G 3: 33,007,333 (GRCm39) V481A probably damaging Het
Plekhh3 C A 11: 101,057,225 (GRCm39) R344L probably benign Het
Prrc2b T C 2: 32,104,953 (GRCm39) V1477A probably benign Het
Ptp4a2 G A 4: 129,738,945 (GRCm39) G94S possibly damaging Het
Ptprk T A 10: 28,359,203 (GRCm39) Y598* probably null Het
Rfx5 C A 3: 94,864,475 (GRCm39) T207N probably damaging Het
Rnase2b A G 14: 51,400,347 (GRCm39) T143A possibly damaging Het
Scn1a A G 2: 66,168,330 (GRCm39) V92A probably benign Het
Shank2 C A 7: 143,965,265 (GRCm39) P958T probably damaging Het
Slc13a1 A G 6: 24,108,194 (GRCm39) I294T probably damaging Het
Slc4a8 A T 15: 100,712,421 (GRCm39) E1084D probably benign Het
Smurf1 T A 5: 144,820,422 (GRCm39) R549* probably null Het
Spmip10 T C 18: 56,725,537 (GRCm39) F66L probably damaging Het
Sprr2b T C 3: 92,225,032 (GRCm39) C93R unknown Het
Tcn2 G T 11: 3,873,569 (GRCm39) S259Y probably damaging Het
Tent4a G T 13: 69,651,828 (GRCm39) T531N possibly damaging Het
Tle1 A G 4: 72,076,525 (GRCm39) S168P possibly damaging Het
Tnfrsf1b C T 4: 144,950,150 (GRCm39) G264D probably damaging Het
Tnks2 T A 19: 36,823,088 (GRCm39) N118K probably damaging Het
Topaz1 G T 9: 122,626,930 (GRCm39) probably benign Het
Traf3ip1 A G 1: 91,443,796 (GRCm39) probably benign Het
Ttk A G 9: 83,721,322 (GRCm39) E69G probably damaging Het
Usp38 C T 8: 81,708,479 (GRCm39) G1033D probably damaging Het
Usp44 T A 10: 93,693,775 (GRCm39) N707K probably benign Het
Vipas39 T A 12: 87,305,858 (GRCm39) R112* probably null Het
Vmn1r185 A C 7: 26,311,206 (GRCm39) S100A probably damaging Het
Vmn1r209 T C 13: 22,990,223 (GRCm39) M156V probably benign Het
Vmn1r3 G A 4: 3,184,863 (GRCm39) T148I probably benign Het
Wdr41 G A 13: 95,151,620 (GRCm39) R260H probably benign Het
Wdr90 G A 17: 26,076,146 (GRCm39) R104C Het
Wnk2 A T 13: 49,221,711 (GRCm39) H1183Q possibly damaging Het
Zfp667 A T 7: 6,308,256 (GRCm39) H308L possibly damaging Het
Zfp952 A G 17: 33,220,628 (GRCm39) N18D possibly damaging Het
Other mutations in Tulp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Tulp3 APN 6 128,302,847 (GRCm39) missense probably damaging 0.99
IGL01327:Tulp3 APN 6 128,304,597 (GRCm39) missense probably damaging 1.00
IGL01382:Tulp3 APN 6 128,302,033 (GRCm39) missense probably damaging 1.00
IGL01633:Tulp3 APN 6 128,302,923 (GRCm39) missense probably damaging 1.00
IGL02228:Tulp3 APN 6 128,311,448 (GRCm39) missense probably damaging 1.00
IGL02372:Tulp3 APN 6 128,304,561 (GRCm39) missense possibly damaging 0.92
D4043:Tulp3 UTSW 6 128,301,113 (GRCm39) missense probably benign 0.06
R0243:Tulp3 UTSW 6 128,302,921 (GRCm39) nonsense probably null
R1181:Tulp3 UTSW 6 128,302,915 (GRCm39) missense possibly damaging 0.47
R1673:Tulp3 UTSW 6 128,310,906 (GRCm39) splice site probably null
R1749:Tulp3 UTSW 6 128,314,722 (GRCm39) missense probably damaging 1.00
R1984:Tulp3 UTSW 6 128,303,769 (GRCm39) missense probably benign 0.02
R1985:Tulp3 UTSW 6 128,303,769 (GRCm39) missense probably benign 0.02
R2568:Tulp3 UTSW 6 128,304,601 (GRCm39) missense probably benign 0.00
R4660:Tulp3 UTSW 6 128,300,017 (GRCm39) utr 3 prime probably benign
R4779:Tulp3 UTSW 6 128,300,083 (GRCm39) missense probably damaging 1.00
R5001:Tulp3 UTSW 6 128,302,031 (GRCm39) missense probably damaging 1.00
R6192:Tulp3 UTSW 6 128,332,703 (GRCm39) splice site probably null
R6242:Tulp3 UTSW 6 128,300,050 (GRCm39) missense probably damaging 1.00
R7464:Tulp3 UTSW 6 128,303,792 (GRCm39) missense probably benign 0.00
R7782:Tulp3 UTSW 6 128,301,943 (GRCm39) missense possibly damaging 0.69
R7883:Tulp3 UTSW 6 128,303,807 (GRCm39) missense probably damaging 1.00
R8027:Tulp3 UTSW 6 128,311,436 (GRCm39) missense probably benign 0.00
R8235:Tulp3 UTSW 6 128,304,640 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGATACCCCGTCTTAAGCTC -3'
(R):5'- ACATTGTCTGGCACTGAGC -3'

Sequencing Primer
(F):5'- GCACCATCCTCACCGTG -3'
(R):5'- GCACTGAGCCACTCCCC -3'
Posted On 2021-08-02