Incidental Mutation 'R8919:Or52k2'
ID 679124
Institutional Source Beutler Lab
Gene Symbol Or52k2
Ensembl Gene ENSMUSG00000073973
Gene Name olfactory receptor family 52 subfamily K member 2
Synonyms GA_x6K02T2PBJ9-5323062-5324015, Olfr552, MOR28-1
MMRRC Submission 068706-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R8919 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102253563-102254516 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102253711 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 50 (I50N)
Ref Sequence ENSEMBL: ENSMUSP00000150317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098223] [ENSMUST00000215712]
AlphaFold E9Q545
Predicted Effect probably damaging
Transcript: ENSMUST00000098223
AA Change: I50N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095826
Gene: ENSMUSG00000073973
AA Change: I50N

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 6e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 270 4.4e-8 PFAM
Pfam:7tm_1 43 294 9.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215712
AA Change: I50N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat C T 8: 60,993,158 (GRCm39) T373I possibly damaging Het
Abca13 T C 11: 9,241,653 (GRCm39) L1172P possibly damaging Het
Abcg2 A G 6: 58,661,326 (GRCm39) Y459C probably benign Het
AC125199.3 T C 16: 88,609,061 (GRCm39) N4D possibly damaging Het
Acad8 A G 9: 26,910,785 (GRCm39) M3T probably benign Het
Acsbg3 A C 17: 57,189,218 (GRCm39) I209L probably benign Het
Adcyap1r1 C T 6: 55,474,080 (GRCm39) T472I probably damaging Het
Ank3 A T 10: 69,840,671 (GRCm39) K1890N possibly damaging Het
Asic1 G A 15: 99,569,826 (GRCm39) C49Y probably benign Het
Atp1a1 T C 3: 101,498,547 (GRCm39) N215S probably damaging Het
C87436 A G 6: 86,422,774 (GRCm39) Y116C probably damaging Het
Car5a T C 8: 122,671,519 (GRCm39) D5G probably benign Het
Ccdc169 T C 3: 55,058,368 (GRCm39) probably null Het
Ccdc93 A G 1: 121,426,970 (GRCm39) R586G probably damaging Het
Cep295 A G 9: 15,238,007 (GRCm39) V131A probably damaging Het
Cox5a A G 9: 57,436,329 (GRCm39) D60G possibly damaging Het
Cpne6 A T 14: 55,750,104 (GRCm39) E78D probably benign Het
Cyp2u1 T C 3: 131,089,114 (GRCm39) E390G probably damaging Het
Dab2 C A 15: 6,465,271 (GRCm39) N707K Het
Dock10 A T 1: 80,483,147 (GRCm39) D2101E probably benign Het
Duoxa2 G A 2: 122,132,357 (GRCm39) probably null Het
Eif4a3 T C 11: 119,190,758 (GRCm39) D22G probably benign Het
Fhip1b T C 7: 105,037,477 (GRCm39) T369A possibly damaging Het
Fubp3 A G 2: 31,482,476 (GRCm39) probably null Het
Gm10330 A G 12: 23,829,887 (GRCm39) L98P probably benign Het
Gm5108 A G 5: 68,134,299 (GRCm39) *102W probably null Het
Gpr149 A C 3: 62,438,478 (GRCm39) S560A probably damaging Het
Haspin T C 11: 73,027,430 (GRCm39) D553G probably benign Het
Hsf1 C T 15: 76,382,051 (GRCm39) H104Y probably benign Het
Ifi203 T C 1: 173,756,494 (GRCm39) T430A unknown Het
Itih2 G A 2: 10,102,822 (GRCm39) Q771* probably null Het
Kazald1 T A 19: 45,065,395 (GRCm39) L92Q probably damaging Het
Krt19 T C 11: 100,031,980 (GRCm39) E324G probably damaging Het
Lrrc28 A T 7: 67,268,833 (GRCm39) V79E possibly damaging Het
Ltn1 T A 16: 87,178,381 (GRCm39) Q1616L probably damaging Het
Mdc1 A G 17: 36,158,843 (GRCm39) K408E probably benign Het
Nalcn A T 14: 123,561,284 (GRCm39) M738K probably benign Het
Ncoa4 T C 14: 31,894,848 (GRCm39) L125P probably damaging Het
Ncor2 G T 5: 125,106,253 (GRCm39) R810S Het
Neb C T 2: 52,127,141 (GRCm39) G348D Het
Nfat5 T A 8: 108,095,228 (GRCm39) F1156L probably damaging Het
Oit3 G A 10: 59,277,468 (GRCm39) T13I unknown Het
Opa1 A C 16: 29,424,340 (GRCm39) Q230P probably damaging Het
Or10j3b T C 1: 173,044,064 (GRCm39) I282T probably damaging Het
Or5p66 A G 7: 107,886,289 (GRCm39) F15L probably damaging Het
Or5w12 A C 2: 87,502,567 (GRCm39) L48W probably damaging Het
Or6c5b G T 10: 129,246,082 (GRCm39) M282I probably benign Het
Parpbp T C 10: 87,946,189 (GRCm39) H410R probably null Het
Pex5l A G 3: 33,007,333 (GRCm39) V481A probably damaging Het
Plekhh3 C A 11: 101,057,225 (GRCm39) R344L probably benign Het
Prrc2b T C 2: 32,104,953 (GRCm39) V1477A probably benign Het
Ptp4a2 G A 4: 129,738,945 (GRCm39) G94S possibly damaging Het
Ptprk T A 10: 28,359,203 (GRCm39) Y598* probably null Het
Rfx5 C A 3: 94,864,475 (GRCm39) T207N probably damaging Het
Rnase2b A G 14: 51,400,347 (GRCm39) T143A possibly damaging Het
Scn1a A G 2: 66,168,330 (GRCm39) V92A probably benign Het
Shank2 C A 7: 143,965,265 (GRCm39) P958T probably damaging Het
Slc13a1 A G 6: 24,108,194 (GRCm39) I294T probably damaging Het
Slc4a8 A T 15: 100,712,421 (GRCm39) E1084D probably benign Het
Smurf1 T A 5: 144,820,422 (GRCm39) R549* probably null Het
Spmip10 T C 18: 56,725,537 (GRCm39) F66L probably damaging Het
Sprr2b T C 3: 92,225,032 (GRCm39) C93R unknown Het
Tcn2 G T 11: 3,873,569 (GRCm39) S259Y probably damaging Het
Tent4a G T 13: 69,651,828 (GRCm39) T531N possibly damaging Het
Tle1 A G 4: 72,076,525 (GRCm39) S168P possibly damaging Het
Tnfrsf1b C T 4: 144,950,150 (GRCm39) G264D probably damaging Het
Tnks2 T A 19: 36,823,088 (GRCm39) N118K probably damaging Het
Topaz1 G T 9: 122,626,930 (GRCm39) probably benign Het
Traf3ip1 A G 1: 91,443,796 (GRCm39) probably benign Het
Ttk A G 9: 83,721,322 (GRCm39) E69G probably damaging Het
Tulp3 T C 6: 128,310,966 (GRCm39) D87G probably benign Het
Usp38 C T 8: 81,708,479 (GRCm39) G1033D probably damaging Het
Usp44 T A 10: 93,693,775 (GRCm39) N707K probably benign Het
Vipas39 T A 12: 87,305,858 (GRCm39) R112* probably null Het
Vmn1r185 A C 7: 26,311,206 (GRCm39) S100A probably damaging Het
Vmn1r209 T C 13: 22,990,223 (GRCm39) M156V probably benign Het
Vmn1r3 G A 4: 3,184,863 (GRCm39) T148I probably benign Het
Wdr41 G A 13: 95,151,620 (GRCm39) R260H probably benign Het
Wdr90 G A 17: 26,076,146 (GRCm39) R104C Het
Wnk2 A T 13: 49,221,711 (GRCm39) H1183Q possibly damaging Het
Zfp667 A T 7: 6,308,256 (GRCm39) H308L possibly damaging Het
Zfp952 A G 17: 33,220,628 (GRCm39) N18D possibly damaging Het
Other mutations in Or52k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Or52k2 APN 7 102,253,564 (GRCm39) start codon destroyed probably null 0.99
IGL03061:Or52k2 APN 7 102,253,946 (GRCm39) missense probably damaging 0.99
R0989:Or52k2 UTSW 7 102,253,690 (GRCm39) missense probably damaging 1.00
R1513:Or52k2 UTSW 7 102,254,509 (GRCm39) missense probably benign 0.09
R1969:Or52k2 UTSW 7 102,253,777 (GRCm39) missense probably damaging 0.99
R3177:Or52k2 UTSW 7 102,253,783 (GRCm39) missense possibly damaging 0.94
R3277:Or52k2 UTSW 7 102,253,783 (GRCm39) missense possibly damaging 0.94
R4019:Or52k2 UTSW 7 102,253,849 (GRCm39) missense probably damaging 1.00
R4028:Or52k2 UTSW 7 102,254,500 (GRCm39) missense possibly damaging 0.62
R5216:Or52k2 UTSW 7 102,254,028 (GRCm39) missense probably benign 0.00
R5444:Or52k2 UTSW 7 102,254,076 (GRCm39) nonsense probably null
R5461:Or52k2 UTSW 7 102,253,615 (GRCm39) missense probably damaging 0.99
R7706:Or52k2 UTSW 7 102,253,853 (GRCm39) missense probably benign 0.12
R8348:Or52k2 UTSW 7 102,254,207 (GRCm39) missense probably benign 0.01
R8448:Or52k2 UTSW 7 102,254,207 (GRCm39) missense probably benign 0.01
R8933:Or52k2 UTSW 7 102,253,637 (GRCm39) missense probably damaging 1.00
R9009:Or52k2 UTSW 7 102,253,642 (GRCm39) missense probably benign 0.00
R9139:Or52k2 UTSW 7 102,254,185 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCTGTGGAAGTAGATTGGAAG -3'
(R):5'- GGCCAACAACATTGCTGACTC -3'

Sequencing Primer
(F):5'- GGCCTAGAGCACTTACAT -3'
(R):5'- CATTGCTGACTCCATGATAGCAAAGG -3'
Posted On 2021-08-02