Incidental Mutation 'R8919:Olfr552'
ID 679124
Institutional Source Beutler Lab
Gene Symbol Olfr552
Ensembl Gene ENSMUSG00000073973
Gene Name olfactory receptor 552
Synonyms GA_x6K02T2PBJ9-5323062-5324015, MOR28-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R8919 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102597770-102608125 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102604504 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 50 (I50N)
Ref Sequence ENSEMBL: ENSMUSP00000150317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098223] [ENSMUST00000215712]
AlphaFold E9Q545
Predicted Effect probably damaging
Transcript: ENSMUST00000098223
AA Change: I50N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095826
Gene: ENSMUSG00000073973
AA Change: I50N

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 6e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 270 4.4e-8 PFAM
Pfam:7tm_1 43 294 9.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215712
AA Change: I50N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A C 17: 56,882,218 I209L probably benign Het
Aadat C T 8: 60,540,124 T373I possibly damaging Het
Abca13 T C 11: 9,291,653 L1172P possibly damaging Het
Abcg2 A G 6: 58,684,341 Y459C probably benign Het
AC125199.3 T C 16: 88,812,173 N4D possibly damaging Het
Acad8 A G 9: 26,999,489 M3T probably benign Het
Adcyap1r1 C T 6: 55,497,095 T472I probably damaging Het
Ank3 A T 10: 70,004,841 K1890N possibly damaging Het
Asic1 G A 15: 99,671,945 C49Y probably benign Het
Atp1a1 T C 3: 101,591,231 N215S probably damaging Het
C87436 A G 6: 86,445,792 Y116C probably damaging Het
Car5a T C 8: 121,944,780 D5G probably benign Het
Ccdc169 T C 3: 55,150,947 probably null Het
Ccdc93 A G 1: 121,499,241 R586G probably damaging Het
Cep295 A G 9: 15,326,711 V131A probably damaging Het
Cox5a A G 9: 57,529,046 D60G possibly damaging Het
Cpne6 A T 14: 55,512,647 E78D probably benign Het
Cyp2u1 T C 3: 131,295,465 E390G probably damaging Het
Dab2 C A 15: 6,435,790 N707K Het
Dock10 A T 1: 80,505,430 D2101E probably benign Het
Duoxa2 G A 2: 122,301,876 probably null Het
Eif4a3 T C 11: 119,299,932 D22G probably benign Het
Fam160a2 T C 7: 105,388,270 T369A possibly damaging Het
Fubp3 A G 2: 31,592,464 probably null Het
Gm10330 A G 12: 23,779,886 L98P probably benign Het
Gm5108 A G 5: 67,976,956 *102W probably null Het
Gpr149 A C 3: 62,531,057 S560A probably damaging Het
Haspin T C 11: 73,136,604 D553G probably benign Het
Hsf1 C T 15: 76,497,851 H104Y probably benign Het
Ifi203 T C 1: 173,928,928 T430A unknown Het
Itih2 G A 2: 10,098,011 Q771* probably null Het
Kazald1 T A 19: 45,076,956 L92Q probably damaging Het
Krt19 T C 11: 100,141,154 E324G probably damaging Het
Lrrc28 A T 7: 67,619,085 V79E possibly damaging Het
Ltn1 T A 16: 87,381,493 Q1616L probably damaging Het
Mdc1 A G 17: 35,847,951 K408E probably benign Het
Nalcn A T 14: 123,323,872 M738K probably benign Het
Ncoa4 T C 14: 32,172,891 L125P probably damaging Het
Ncor2 G T 5: 125,029,189 R810S Het
Neb C T 2: 52,237,129 G348D Het
Nfat5 T A 8: 107,368,596 F1156L probably damaging Het
Oit3 G A 10: 59,441,646 T13I unknown Het
Olfr1135 A C 2: 87,672,223 L48W probably damaging Het
Olfr1404 T C 1: 173,216,497 I282T probably damaging Het
Olfr490 A G 7: 108,287,082 F15L probably damaging Het
Olfr785 G T 10: 129,410,213 M282I probably benign Het
Opa1 A C 16: 29,605,522 Q230P probably damaging Het
Papd7 G T 13: 69,503,709 T531N possibly damaging Het
Parpbp T C 10: 88,110,327 H410R probably null Het
Pex5l A G 3: 32,953,184 V481A probably damaging Het
Plekhh3 C A 11: 101,166,399 R344L probably benign Het
Prrc2b T C 2: 32,214,941 V1477A probably benign Het
Ptp4a2 G A 4: 129,845,152 G94S possibly damaging Het
Ptprk T A 10: 28,483,207 Y598* probably null Het
Rfx5 C A 3: 94,957,164 T207N probably damaging Het
Rnase2b A G 14: 51,162,890 T143A possibly damaging Het
Scn1a A G 2: 66,337,986 V92A probably benign Het
Shank2 C A 7: 144,411,528 P958T probably damaging Het
Slc13a1 A G 6: 24,108,195 I294T probably damaging Het
Slc4a8 A T 15: 100,814,540 E1084D probably benign Het
Smurf1 T A 5: 144,883,612 R549* probably null Het
Sprr2b T C 3: 92,317,725 C93R unknown Het
Tcn2 G T 11: 3,923,569 S259Y probably damaging Het
Tex43 T C 18: 56,592,465 F66L probably damaging Het
Tle1 A G 4: 72,158,288 S168P possibly damaging Het
Tnfrsf1b C T 4: 145,223,580 G264D probably damaging Het
Tnks2 T A 19: 36,845,688 N118K probably damaging Het
Topaz1 G T 9: 122,797,865 probably benign Het
Traf3ip1 A G 1: 91,516,074 probably benign Het
Ttk A G 9: 83,839,269 E69G probably damaging Het
Tulp3 T C 6: 128,334,003 D87G probably benign Het
Usp38 C T 8: 80,981,850 G1033D probably damaging Het
Usp44 T A 10: 93,857,913 N707K probably benign Het
Vipas39 T A 12: 87,259,084 R112* probably null Het
Vmn1r185 A C 7: 26,611,781 S100A probably damaging Het
Vmn1r209 T C 13: 22,806,053 M156V probably benign Het
Vmn1r3 G A 4: 3,184,863 T148I probably benign Het
Wdr41 G A 13: 95,015,112 R260H probably benign Het
Wdr90 G A 17: 25,857,172 R104C Het
Wnk2 A T 13: 49,068,235 H1183Q possibly damaging Het
Zfp667 A T 7: 6,305,257 H308L possibly damaging Het
Zfp952 A G 17: 33,001,654 N18D possibly damaging Het
Other mutations in Olfr552
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr552 APN 7 102604357 start codon destroyed probably null 0.99
IGL03061:Olfr552 APN 7 102604739 missense probably damaging 0.99
R0989:Olfr552 UTSW 7 102604483 missense probably damaging 1.00
R1513:Olfr552 UTSW 7 102605302 missense probably benign 0.09
R1969:Olfr552 UTSW 7 102604570 missense probably damaging 0.99
R3177:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R3277:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R4019:Olfr552 UTSW 7 102604642 missense probably damaging 1.00
R4028:Olfr552 UTSW 7 102605293 missense possibly damaging 0.62
R5216:Olfr552 UTSW 7 102604821 missense probably benign 0.00
R5444:Olfr552 UTSW 7 102604869 nonsense probably null
R5461:Olfr552 UTSW 7 102604408 missense probably damaging 0.99
R7706:Olfr552 UTSW 7 102604646 missense probably benign 0.12
R8348:Olfr552 UTSW 7 102605000 missense probably benign 0.01
R8448:Olfr552 UTSW 7 102605000 missense probably benign 0.01
R8933:Olfr552 UTSW 7 102604430 missense probably damaging 1.00
R9009:Olfr552 UTSW 7 102604435 missense probably benign 0.00
R9139:Olfr552 UTSW 7 102604978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCTGTGGAAGTAGATTGGAAG -3'
(R):5'- GGCCAACAACATTGCTGACTC -3'

Sequencing Primer
(F):5'- GGCCTAGAGCACTTACAT -3'
(R):5'- CATTGCTGACTCCATGATAGCAAAGG -3'
Posted On 2021-08-02