Mutagenetix > Incidental Mutation

Incidental Mutation 'R8919:Shank2'

679127

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8919 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144001928-144424494 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 144411528 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 958 (P958T)

Ref Sequence

ENSEMBL: ENSMUSP00000146440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097929] [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000146006]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000097929
AA Change: P951T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095542
Gene: ENSMUSG00000037541
AA Change: P951T

Domain	Start	End	E-Value	Type
PDZ	46	131	1.75e-14	SMART
low complexity region	135	154	N/A	INTRINSIC
low complexity region	299	314	N/A	INTRINSIC
low complexity region	452	464	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	570	582	N/A	INTRINSIC
low complexity region	619	637	N/A	INTRINSIC
low complexity region	814	828	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	915	937	N/A	INTRINSIC
low complexity region	951	967	N/A	INTRINSIC
low complexity region	989	997	N/A	INTRINSIC
low complexity region	1077	1091	N/A	INTRINSIC
low complexity region	1134	1149	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
SAM	1196	1262	2.52e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105900
AA Change: P1168T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: P1168T

Domain	Start	End	E-Value	Type
SH3	150	205	1.04e-14	SMART
PDZ	256	341	1.75e-14	SMART
low complexity region	345	364	N/A	INTRINSIC
low complexity region	509	524	N/A	INTRINSIC
low complexity region	662	674	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	829	847	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1093	1104	N/A	INTRINSIC
low complexity region	1125	1147	N/A	INTRINSIC
low complexity region	1161	1177	N/A	INTRINSIC
low complexity region	1199	1207	N/A	INTRINSIC
low complexity region	1287	1301	N/A	INTRINSIC
low complexity region	1344	1359	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
SAM	1406	1472	2.52e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105902
AA Change: P1537T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: P1537T

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000146006
AA Change: P958T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	C	17: 56,882,218	I209L	probably benign	Het
Aadat	C	T	8: 60,540,124	T373I	possibly damaging	Het
Abca13	T	C	11: 9,291,653	L1172P	possibly damaging	Het
Abcg2	A	G	6: 58,684,341	Y459C	probably benign	Het
AC125199.3	T	C	16: 88,812,173	N4D	possibly damaging	Het
Acad8	A	G	9: 26,999,489	M3T	probably benign	Het
Adcyap1r1	C	T	6: 55,497,095	T472I	probably damaging	Het
Ank3	A	T	10: 70,004,841	K1890N	possibly damaging	Het
Asic1	G	A	15: 99,671,945	C49Y	probably benign	Het
Atp1a1	T	C	3: 101,591,231	N215S	probably damaging	Het
C87436	A	G	6: 86,445,792	Y116C	probably damaging	Het
Car5a	T	C	8: 121,944,780	D5G	probably benign	Het
Ccdc169	T	C	3: 55,150,947		probably null	Het
Ccdc93	A	G	1: 121,499,241	R586G	probably damaging	Het
Cep295	A	G	9: 15,326,711	V131A	probably damaging	Het
Cox5a	A	G	9: 57,529,046	D60G	possibly damaging	Het
Cpne6	A	T	14: 55,512,647	E78D	probably benign	Het
Cyp2u1	T	C	3: 131,295,465	E390G	probably damaging	Het
Dab2	C	A	15: 6,435,790	N707K		Het
Dock10	A	T	1: 80,505,430	D2101E	probably benign	Het
Duoxa2	G	A	2: 122,301,876		probably null	Het
Eif4a3	T	C	11: 119,299,932	D22G	probably benign	Het
Fam160a2	T	C	7: 105,388,270	T369A	possibly damaging	Het
Fubp3	A	G	2: 31,592,464		probably null	Het
Gm10330	A	G	12: 23,779,886	L98P	probably benign	Het
Gm5108	A	G	5: 67,976,956	*102W	probably null	Het
Gpr149	A	C	3: 62,531,057	S560A	probably damaging	Het
Haspin	T	C	11: 73,136,604	D553G	probably benign	Het
Hsf1	C	T	15: 76,497,851	H104Y	probably benign	Het
Ifi203	T	C	1: 173,928,928	T430A	unknown	Het
Itih2	G	A	2: 10,098,011	Q771*	probably null	Het
Kazald1	T	A	19: 45,076,956	L92Q	probably damaging	Het
Krt19	T	C	11: 100,141,154	E324G	probably damaging	Het
Lrrc28	A	T	7: 67,619,085	V79E	possibly damaging	Het
Ltn1	T	A	16: 87,381,493	Q1616L	probably damaging	Het
Mdc1	A	G	17: 35,847,951	K408E	probably benign	Het
Nalcn	A	T	14: 123,323,872	M738K	probably benign	Het
Ncoa4	T	C	14: 32,172,891	L125P	probably damaging	Het
Ncor2	G	T	5: 125,029,189	R810S		Het
Neb	C	T	2: 52,237,129	G348D		Het
Nfat5	T	A	8: 107,368,596	F1156L	probably damaging	Het
Oit3	G	A	10: 59,441,646	T13I	unknown	Het
Olfr1135	A	C	2: 87,672,223	L48W	probably damaging	Het
Olfr1404	T	C	1: 173,216,497	I282T	probably damaging	Het
Olfr490	A	G	7: 108,287,082	F15L	probably damaging	Het
Olfr552	T	A	7: 102,604,504	I50N	probably damaging	Het
Olfr785	G	T	10: 129,410,213	M282I	probably benign	Het
Opa1	A	C	16: 29,605,522	Q230P	probably damaging	Het
Papd7	G	T	13: 69,503,709	T531N	possibly damaging	Het
Parpbp	T	C	10: 88,110,327	H410R	probably null	Het
Pex5l	A	G	3: 32,953,184	V481A	probably damaging	Het
Plekhh3	C	A	11: 101,166,399	R344L	probably benign	Het
Prrc2b	T	C	2: 32,214,941	V1477A	probably benign	Het
Ptp4a2	G	A	4: 129,845,152	G94S	possibly damaging	Het
Ptprk	T	A	10: 28,483,207	Y598*	probably null	Het
Rfx5	C	A	3: 94,957,164	T207N	probably damaging	Het
Rnase2b	A	G	14: 51,162,890	T143A	possibly damaging	Het
Scn1a	A	G	2: 66,337,986	V92A	probably benign	Het
Slc13a1	A	G	6: 24,108,195	I294T	probably damaging	Het
Slc4a8	A	T	15: 100,814,540	E1084D	probably benign	Het
Smurf1	T	A	5: 144,883,612	R549*	probably null	Het
Sprr2b	T	C	3: 92,317,725	C93R	unknown	Het
Tcn2	G	T	11: 3,923,569	S259Y	probably damaging	Het
Tex43	T	C	18: 56,592,465	F66L	probably damaging	Het
Tle1	A	G	4: 72,158,288	S168P	possibly damaging	Het
Tnfrsf1b	C	T	4: 145,223,580	G264D	probably damaging	Het
Tnks2	T	A	19: 36,845,688	N118K	probably damaging	Het
Topaz1	G	T	9: 122,797,865		probably benign	Het
Traf3ip1	A	G	1: 91,516,074		probably benign	Het
Ttk	A	G	9: 83,839,269	E69G	probably damaging	Het
Tulp3	T	C	6: 128,334,003	D87G	probably benign	Het
Usp38	C	T	8: 80,981,850	G1033D	probably damaging	Het
Usp44	T	A	10: 93,857,913	N707K	probably benign	Het
Vipas39	T	A	12: 87,259,084	R112*	probably null	Het
Vmn1r185	A	C	7: 26,611,781	S100A	probably damaging	Het
Vmn1r209	T	C	13: 22,806,053	M156V	probably benign	Het
Vmn1r3	G	A	4: 3,184,863	T148I	probably benign	Het
Wdr41	G	A	13: 95,015,112	R260H	probably benign	Het
Wdr90	G	A	17: 25,857,172	R104C		Het
Wnk2	A	T	13: 49,068,235	H1183Q	possibly damaging	Het
Zfp667	A	T	7: 6,305,257	H308L	possibly damaging	Het
Zfp952	A	G	17: 33,001,654	N18D	possibly damaging	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	144411847	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	144410775	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	144411271	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	144285068	nonsense	probably null
IGL01996:Shank2	APN	7	144411493	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	144285047	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	144411271	missense	probably benign	0.01
IGL02320:Shank2	APN	7	144420944	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	144409636	missense	probably benign	0.03
IGL02997:Shank2	APN	7	144081873	missense	probably benign	0.16
R0077:Shank2	UTSW	7	144192467	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	144410577	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	144031355	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	144070135	missense	probably benign	0.04
R0644:Shank2	UTSW	7	144411849	missense	probably benign
R1072:Shank2	UTSW	7	144411568	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	144411720	missense	probably benign	0.00
R1424:Shank2	UTSW	7	144052372	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	144411153	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	144179853	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	144410599	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	144186858	nonsense	probably null
R2074:Shank2	UTSW	7	144409540	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	144411234	missense	probably damaging	0.99
R2355:Shank2	UTSW	7	144057718	missense	possibly damaging	0.94
R2511:Shank2	UTSW	7	144411577	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	144052305	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	144068770	missense	probably damaging	1.00
R2846:Shank2	UTSW	7	144070055	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	144081874	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	144405384	missense	probably benign
R3907:Shank2	UTSW	7	144409576	missense	probably damaging	1.00
R3938:Shank2	UTSW	7	144128375	missense	probably benign	0.20
R4151:Shank2	UTSW	7	144054828	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	144179781	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	144410862	missense	probably benign	0.09
R4519:Shank2	UTSW	7	144410205	missense	probably damaging	1.00
R4627:Shank2	UTSW	7	144411424	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	144410422	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	144411829	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	144420605	missense	probably benign	0.07
R4751:Shank2	UTSW	7	144409468	missense	probably damaging	1.00
R4816:Shank2	UTSW	7	144052306	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R4929:Shank2	UTSW	7	144411271	missense	probably benign	0.01
R5009:Shank2	UTSW	7	144070179	missense	probably benign	0.00
R5027:Shank2	UTSW	7	144259105	nonsense	probably null
R5165:Shank2	UTSW	7	144409636	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	144068875	critical splice donor site	probably null
R5332:Shank2	UTSW	7	144411292	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R5525:Shank2	UTSW	7	144070109	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	144410134	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	144407223	missense	probably damaging	0.98
R6024:Shank2	UTSW	7	144180031	missense	probably benign	0.12
R6306:Shank2	UTSW	7	144409680	missense	probably benign	0.00
R6317:Shank2	UTSW	7	144285084	missense	possibly damaging	0.89
R6358:Shank2	UTSW	7	144031297	missense	probably benign	0.25
R6364:Shank2	UTSW	7	144410409	missense	probably benign	0.14
R6413:Shank2	UTSW	7	144410218	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	144420866	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	144409894	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	144052460	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	144091778	missense	probably benign	0.19
R6983:Shank2	UTSW	7	144081848	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	144410359	missense	probably damaging	0.99
R7100:Shank2	UTSW	7	144411164	missense	possibly damaging	0.73
R7111:Shank2	UTSW	7	144411552	missense	probably benign	0.00
R7213:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R7225:Shank2	UTSW	7	144285025	missense	probably benign	0.42
R7325:Shank2	UTSW	7	144411685	missense	probably benign	0.04
R7605:Shank2	UTSW	7	144091779	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	144411394	missense	probably damaging	1.00
R7976:Shank2	UTSW	7	144411061	missense	probably damaging	0.99
R8118:Shank2	UTSW	7	144409875	missense	probably benign	0.01
R8722:Shank2	UTSW	7	144175748	intron	probably benign
R8866:Shank2	UTSW	7	144411249	missense	probably benign
R8944:Shank2	UTSW	7	144070190	missense	probably damaging	1.00
R9033:Shank2	UTSW	7	144411499	missense	probably damaging	0.99
R9091:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9252:Shank2	UTSW	7	144068798	missense	possibly damaging	0.96
R9270:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9350:Shank2	UTSW	7	144407208	missense	probably benign	0.00
R9362:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R9471:Shank2	UTSW	7	144411015	missense	possibly damaging	0.77
R9524:Shank2	UTSW	7	144410446	missense	possibly damaging	0.71
R9557:Shank2	UTSW	7	144410110	missense	probably benign	0.00
R9559:Shank2	UTSW	7	144031304	missense	probably benign	0.30
R9574:Shank2	UTSW	7	144068725	missense	possibly damaging	0.90
R9680:Shank2	UTSW	7	144411100	missense	probably damaging	0.96
R9720:Shank2	UTSW	7	144128400	missense	probably damaging	0.99
RF009:Shank2	UTSW	7	144411571	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	144128377	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAAGTTTCGATGCAGTCACCG -3'
(R):5'- GGGCTTTTGACCTCTGGAAC -3'

Sequencing Primer
(F):5'- TTCGATGCAGTCACCGACTCG -3'
(R):5'- TGACCTCTGGAACGTCACC -3'

Posted On

2021-08-02