Incidental Mutation 'R8919:Ptprk'
ID 679136
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Name protein tyrosine phosphatase, receptor type, K
Synonyms RPTPkappa, PTPk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8919 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 28074820-28597397 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 28483207 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 598 (Y598*)
Ref Sequence ENSEMBL: ENSMUSP00000151866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
AlphaFold P35822
Predicted Effect probably null
Transcript: ENSMUST00000166468
AA Change: Y598*
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: Y598*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably null
Transcript: ENSMUST00000218276
AA Change: Y598*
Predicted Effect probably null
Transcript: ENSMUST00000218359
AA Change: Y598*
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A C 17: 56,882,218 I209L probably benign Het
Aadat C T 8: 60,540,124 T373I possibly damaging Het
Abca13 T C 11: 9,291,653 L1172P possibly damaging Het
Abcg2 A G 6: 58,684,341 Y459C probably benign Het
AC125199.3 T C 16: 88,812,173 N4D possibly damaging Het
Acad8 A G 9: 26,999,489 M3T probably benign Het
Adcyap1r1 C T 6: 55,497,095 T472I probably damaging Het
Ank3 A T 10: 70,004,841 K1890N possibly damaging Het
Asic1 G A 15: 99,671,945 C49Y probably benign Het
Atp1a1 T C 3: 101,591,231 N215S probably damaging Het
C87436 A G 6: 86,445,792 Y116C probably damaging Het
Car5a T C 8: 121,944,780 D5G probably benign Het
Ccdc169 T C 3: 55,150,947 probably null Het
Ccdc93 A G 1: 121,499,241 R586G probably damaging Het
Cep295 A G 9: 15,326,711 V131A probably damaging Het
Cox5a A G 9: 57,529,046 D60G possibly damaging Het
Cpne6 A T 14: 55,512,647 E78D probably benign Het
Cyp2u1 T C 3: 131,295,465 E390G probably damaging Het
Dab2 C A 15: 6,435,790 N707K Het
Dock10 A T 1: 80,505,430 D2101E probably benign Het
Duoxa2 G A 2: 122,301,876 probably null Het
Eif4a3 T C 11: 119,299,932 D22G probably benign Het
Fam160a2 T C 7: 105,388,270 T369A possibly damaging Het
Fubp3 A G 2: 31,592,464 probably null Het
Gm10330 A G 12: 23,779,886 L98P probably benign Het
Gm5108 A G 5: 67,976,956 *102W probably null Het
Gpr149 A C 3: 62,531,057 S560A probably damaging Het
Haspin T C 11: 73,136,604 D553G probably benign Het
Hsf1 C T 15: 76,497,851 H104Y probably benign Het
Ifi203 T C 1: 173,928,928 T430A unknown Het
Itih2 G A 2: 10,098,011 Q771* probably null Het
Kazald1 T A 19: 45,076,956 L92Q probably damaging Het
Krt19 T C 11: 100,141,154 E324G probably damaging Het
Lrrc28 A T 7: 67,619,085 V79E possibly damaging Het
Ltn1 T A 16: 87,381,493 Q1616L probably damaging Het
Mdc1 A G 17: 35,847,951 K408E probably benign Het
Nalcn A T 14: 123,323,872 M738K probably benign Het
Ncoa4 T C 14: 32,172,891 L125P probably damaging Het
Ncor2 G T 5: 125,029,189 R810S Het
Neb C T 2: 52,237,129 G348D Het
Nfat5 T A 8: 107,368,596 F1156L probably damaging Het
Oit3 G A 10: 59,441,646 T13I unknown Het
Olfr1135 A C 2: 87,672,223 L48W probably damaging Het
Olfr1404 T C 1: 173,216,497 I282T probably damaging Het
Olfr490 A G 7: 108,287,082 F15L probably damaging Het
Olfr552 T A 7: 102,604,504 I50N probably damaging Het
Olfr785 G T 10: 129,410,213 M282I probably benign Het
Opa1 A C 16: 29,605,522 Q230P probably damaging Het
Papd7 G T 13: 69,503,709 T531N possibly damaging Het
Parpbp T C 10: 88,110,327 H410R probably null Het
Pex5l A G 3: 32,953,184 V481A probably damaging Het
Plekhh3 C A 11: 101,166,399 R344L probably benign Het
Prrc2b T C 2: 32,214,941 V1477A probably benign Het
Ptp4a2 G A 4: 129,845,152 G94S possibly damaging Het
Rfx5 C A 3: 94,957,164 T207N probably damaging Het
Rnase2b A G 14: 51,162,890 T143A possibly damaging Het
Scn1a A G 2: 66,337,986 V92A probably benign Het
Shank2 C A 7: 144,411,528 P958T probably damaging Het
Slc13a1 A G 6: 24,108,195 I294T probably damaging Het
Slc4a8 A T 15: 100,814,540 E1084D probably benign Het
Smurf1 T A 5: 144,883,612 R549* probably null Het
Sprr2b T C 3: 92,317,725 C93R unknown Het
Tcn2 G T 11: 3,923,569 S259Y probably damaging Het
Tex43 T C 18: 56,592,465 F66L probably damaging Het
Tle1 A G 4: 72,158,288 S168P possibly damaging Het
Tnfrsf1b C T 4: 145,223,580 G264D probably damaging Het
Tnks2 T A 19: 36,845,688 N118K probably damaging Het
Topaz1 G T 9: 122,797,865 probably benign Het
Traf3ip1 A G 1: 91,516,074 probably benign Het
Ttk A G 9: 83,839,269 E69G probably damaging Het
Tulp3 T C 6: 128,334,003 D87G probably benign Het
Usp38 C T 8: 80,981,850 G1033D probably damaging Het
Usp44 T A 10: 93,857,913 N707K probably benign Het
Vipas39 T A 12: 87,259,084 R112* probably null Het
Vmn1r185 A C 7: 26,611,781 S100A probably damaging Het
Vmn1r209 T C 13: 22,806,053 M156V probably benign Het
Vmn1r3 G A 4: 3,184,863 T148I probably benign Het
Wdr41 G A 13: 95,015,112 R260H probably benign Het
Wdr90 G A 17: 25,857,172 R104C Het
Wnk2 A T 13: 49,068,235 H1183Q possibly damaging Het
Zfp667 A T 7: 6,305,257 H308L possibly damaging Het
Zfp952 A G 17: 33,001,654 N18D possibly damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 splice site probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
R7585:Ptprk UTSW 10 28560088 missense probably damaging 1.00
R7661:Ptprk UTSW 10 28466040 missense probably benign 0.00
R7694:Ptprk UTSW 10 28589370 missense possibly damaging 0.63
R7740:Ptprk UTSW 10 28496924 missense probably damaging 1.00
R7810:Ptprk UTSW 10 28592857 missense probably damaging 0.97
R7831:Ptprk UTSW 10 28568408 missense possibly damaging 0.89
R7836:Ptprk UTSW 10 28573389 missense probably damaging 1.00
R8049:Ptprk UTSW 10 28383569 missense possibly damaging 0.84
R8235:Ptprk UTSW 10 28589041 missense possibly damaging 0.70
R8274:Ptprk UTSW 10 28580412 missense probably damaging 1.00
R8286:Ptprk UTSW 10 28568327 missense probably damaging 1.00
R8372:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R8727:Ptprk UTSW 10 28566545 unclassified probably benign
R8794:Ptprk UTSW 10 28263508 nonsense probably null
R8842:Ptprk UTSW 10 28566501 missense probably damaging 0.97
R8861:Ptprk UTSW 10 28570190 missense probably damaging 1.00
R8897:Ptprk UTSW 10 28591957 missense probably damaging 1.00
R8910:Ptprk UTSW 10 28492997 missense possibly damaging 0.68
R8976:Ptprk UTSW 10 28585673 missense probably damaging 1.00
R8982:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R9036:Ptprk UTSW 10 28585932 missense probably benign 0.01
R9135:Ptprk UTSW 10 28580417 missense probably damaging 1.00
R9308:Ptprk UTSW 10 28574854 missense probably benign 0.15
R9317:Ptprk UTSW 10 28354735 missense probably damaging 0.96
Z1177:Ptprk UTSW 10 28493120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAACGTCCCCTTTCTAGC -3'
(R):5'- AGTCCCCTCTTAACTACAGGTC -3'

Sequencing Primer
(F):5'- AGCTTCTTCTGCTAGGGTTAAG -3'
(R):5'- ACAGGTCTATTTGCAATCTTTGTTC -3'
Posted On 2021-08-02