Mutagenetix > Incidental Mutations

Incidental Mutation 'R8919:Ptprk'

679136

Institutional Source

Beutler Lab

Gene Symbol

Ptprk

Ensembl Gene

ENSMUSG00000019889

Gene Name

protein tyrosine phosphatase, receptor type, K

Synonyms

RPTPkappa, PTPk

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8919 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28074820-28597397 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 28483207 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 598 (Y598*)

Ref Sequence

ENSEMBL: ENSMUSP00000151866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]

AlphaFold

P35822

Predicted Effect

probably null
Transcript: ENSMUST00000166468
AA Change: Y598*

SMART Domains

Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: Y598*

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
MAM	30	193	1.61e-73	SMART
IG	200	288	2.16e-8	SMART
FN3	290	373	1.48e-4	SMART
FN3	389	475	4.24e1	SMART
FN3	491	579	3.32e-7	SMART
transmembrane domain	753	774	N/A	INTRINSIC
PTPc	898	1161	3.56e-132	SMART
PTPc	1190	1455	2.68e-86	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000218276
AA Change: Y598*

Predicted Effect

probably null
Transcript: ENSMUST00000218359
AA Change: Y598*

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	C	17: 56,882,218	I209L	probably benign	Het
Aadat	C	T	8: 60,540,124	T373I	possibly damaging	Het
Abca13	T	C	11: 9,291,653	L1172P	possibly damaging	Het
Abcg2	A	G	6: 58,684,341	Y459C	probably benign	Het
AC125199.3	T	C	16: 88,812,173	N4D	possibly damaging	Het
Acad8	A	G	9: 26,999,489	M3T	probably benign	Het
Adcyap1r1	C	T	6: 55,497,095	T472I	probably damaging	Het
Ank3	A	T	10: 70,004,841	K1890N	possibly damaging	Het
Asic1	G	A	15: 99,671,945	C49Y	probably benign	Het
Atp1a1	T	C	3: 101,591,231	N215S	probably damaging	Het
C87436	A	G	6: 86,445,792	Y116C	probably damaging	Het
Car5a	T	C	8: 121,944,780	D5G	probably benign	Het
Ccdc169	T	C	3: 55,150,947		probably null	Het
Ccdc93	A	G	1: 121,499,241	R586G	probably damaging	Het
Cep295	A	G	9: 15,326,711	V131A	probably damaging	Het
Cox5a	A	G	9: 57,529,046	D60G	possibly damaging	Het
Cpne6	A	T	14: 55,512,647	E78D	probably benign	Het
Cyp2u1	T	C	3: 131,295,465	E390G	probably damaging	Het
Dab2	C	A	15: 6,435,790	N707K		Het
Dock10	A	T	1: 80,505,430	D2101E	probably benign	Het
Duoxa2	G	A	2: 122,301,876		probably null	Het
Eif4a3	T	C	11: 119,299,932	D22G	probably benign	Het
Fam160a2	T	C	7: 105,388,270	T369A	possibly damaging	Het
Fubp3	A	G	2: 31,592,464		probably null	Het
Gm10330	A	G	12: 23,779,886	L98P	probably benign	Het
Gm5108	A	G	5: 67,976,956	*102W	probably null	Het
Gpr149	A	C	3: 62,531,057	S560A	probably damaging	Het
Haspin	T	C	11: 73,136,604	D553G	probably benign	Het
Hsf1	C	T	15: 76,497,851	H104Y	probably benign	Het
Ifi203	T	C	1: 173,928,928	T430A	unknown	Het
Itih2	G	A	2: 10,098,011	Q771*	probably null	Het
Kazald1	T	A	19: 45,076,956	L92Q	probably damaging	Het
Krt19	T	C	11: 100,141,154	E324G	probably damaging	Het
Lrrc28	A	T	7: 67,619,085	V79E	possibly damaging	Het
Ltn1	T	A	16: 87,381,493	Q1616L	probably damaging	Het
Mdc1	A	G	17: 35,847,951	K408E	probably benign	Het
Nalcn	A	T	14: 123,323,872	M738K	probably benign	Het
Ncoa4	T	C	14: 32,172,891	L125P	probably damaging	Het
Ncor2	G	T	5: 125,029,189	R810S		Het
Neb	C	T	2: 52,237,129	G348D		Het
Nfat5	T	A	8: 107,368,596	F1156L	probably damaging	Het
Oit3	G	A	10: 59,441,646	T13I	unknown	Het
Olfr1135	A	C	2: 87,672,223	L48W	probably damaging	Het
Olfr1404	T	C	1: 173,216,497	I282T	probably damaging	Het
Olfr490	A	G	7: 108,287,082	F15L	probably damaging	Het
Olfr552	T	A	7: 102,604,504	I50N	probably damaging	Het
Olfr785	G	T	10: 129,410,213	M282I	probably benign	Het
Opa1	A	C	16: 29,605,522	Q230P	probably damaging	Het
Papd7	G	T	13: 69,503,709	T531N	possibly damaging	Het
Parpbp	T	C	10: 88,110,327	H410R	probably null	Het
Pex5l	A	G	3: 32,953,184	V481A	probably damaging	Het
Plekhh3	C	A	11: 101,166,399	R344L	probably benign	Het
Prrc2b	T	C	2: 32,214,941	V1477A	probably benign	Het
Ptp4a2	G	A	4: 129,845,152	G94S	possibly damaging	Het
Rfx5	C	A	3: 94,957,164	T207N	probably damaging	Het
Rnase2b	A	G	14: 51,162,890	T143A	possibly damaging	Het
Scn1a	A	G	2: 66,337,986	V92A	probably benign	Het
Shank2	C	A	7: 144,411,528	P958T	probably damaging	Het
Slc13a1	A	G	6: 24,108,195	I294T	probably damaging	Het
Slc4a8	A	T	15: 100,814,540	E1084D	probably benign	Het
Smurf1	T	A	5: 144,883,612	R549*	probably null	Het
Sprr2b	T	C	3: 92,317,725	C93R	unknown	Het
Tcn2	G	T	11: 3,923,569	S259Y	probably damaging	Het
Tex43	T	C	18: 56,592,465	F66L	probably damaging	Het
Tle1	A	G	4: 72,158,288	S168P	possibly damaging	Het
Tnfrsf1b	C	T	4: 145,223,580	G264D	probably damaging	Het
Tnks2	T	A	19: 36,845,688	N118K	probably damaging	Het
Topaz1	G	T	9: 122,797,865		probably benign	Het
Traf3ip1	A	G	1: 91,516,074		probably benign	Het
Ttk	A	G	9: 83,839,269	E69G	probably damaging	Het
Tulp3	T	C	6: 128,334,003	D87G	probably benign	Het
Usp38	C	T	8: 80,981,850	G1033D	probably damaging	Het
Usp44	T	A	10: 93,857,913	N707K	probably benign	Het
Vipas39	T	A	12: 87,259,084	R112*	probably null	Het
Vmn1r185	A	C	7: 26,611,781	S100A	probably damaging	Het
Vmn1r209	T	C	13: 22,806,053	M156V	probably benign	Het
Vmn1r3	G	A	4: 3,184,863	T148I	probably benign	Het
Wdr41	G	A	13: 95,015,112	R260H	probably benign	Het
Wdr90	G	A	17: 25,857,172	R104C		Het
Wnk2	A	T	13: 49,068,235	H1183Q	possibly damaging	Het
Zfp667	A	T	7: 6,305,257	H308L	possibly damaging	Het
Zfp952	A	G	17: 33,001,654	N18D	possibly damaging	Het

Other mutations in Ptprk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00310:Ptprk	APN	10	28336510	missense	possibly damaging	0.92
IGL00533:Ptprk	APN	10	28585975	missense	probably damaging	0.97
IGL01062:Ptprk	APN	10	28580418	missense	probably damaging	1.00
IGL01295:Ptprk	APN	10	28475178	missense	probably benign	0.14
IGL01372:Ptprk	APN	10	28569927	missense	probably benign	0.00
IGL01452:Ptprk	APN	10	28574917	critical splice donor site	probably null
IGL01829:Ptprk	APN	10	28573387	missense	probably damaging	1.00
IGL01861:Ptprk	APN	10	28383445	missense	possibly damaging	0.80
IGL01955:Ptprk	APN	10	28595865	unclassified	probably benign
IGL02263:Ptprk	APN	10	28075114	missense	unknown
IGL02489:Ptprk	APN	10	28383472	missense	probably damaging	1.00
IGL02697:Ptprk	APN	10	28575618	missense	possibly damaging	0.85
IGL02713:Ptprk	APN	10	28592811	missense	possibly damaging	0.92
IGL02943:Ptprk	APN	10	28475176	missense	possibly damaging	0.81
IGL03240:Ptprk	APN	10	28492961	missense	probably damaging	0.99
IGL03373:Ptprk	APN	10	28566537	missense	probably damaging	1.00
LCD18:Ptprk	UTSW	10	28574987	intron	probably benign
PIT4366001:Ptprk	UTSW	10	28586019	missense	probably benign
R0010:Ptprk	UTSW	10	28585969	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0021:Ptprk	UTSW	10	28592895	missense	probably damaging	1.00
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0035:Ptprk	UTSW	10	28263508	nonsense	probably null
R0053:Ptprk	UTSW	10	28475109	missense	probably damaging	0.99
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0063:Ptprk	UTSW	10	28263767	missense	probably damaging	1.00
R0244:Ptprk	UTSW	10	28206225	missense	possibly damaging	0.79
R0281:Ptprk	UTSW	10	28573392	missense	probably damaging	1.00
R0387:Ptprk	UTSW	10	28354629	missense	possibly damaging	0.66
R0480:Ptprk	UTSW	10	28585947	missense	probably damaging	1.00
R0480:Ptprk	UTSW	10	28585948	missense	probably damaging	1.00
R0585:Ptprk	UTSW	10	28575668	missense	probably damaging	1.00
R0614:Ptprk	UTSW	10	28075136	missense	probably damaging	0.96
R0684:Ptprk	UTSW	10	28483298	splice site	probably benign
R1073:Ptprk	UTSW	10	28496947	critical splice donor site	probably null
R1377:Ptprk	UTSW	10	28586026	missense	probably benign	0.42
R1422:Ptprk	UTSW	10	28475280	missense	possibly damaging	0.64
R1482:Ptprk	UTSW	10	28263516	missense	probably benign	0.24
R1532:Ptprk	UTSW	10	28585630	missense	probably damaging	1.00
R1576:Ptprk	UTSW	10	28551651	missense	probably damaging	1.00
R1618:Ptprk	UTSW	10	28493170	missense	probably benign	0.00
R1654:Ptprk	UTSW	10	28383647	missense	probably damaging	1.00
R1701:Ptprk	UTSW	10	28466058	missense	probably damaging	1.00
R1747:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R2033:Ptprk	UTSW	10	28592767	unclassified	probably benign
R2059:Ptprk	UTSW	10	28566603	missense	probably damaging	1.00
R2076:Ptprk	UTSW	10	28589368	missense	probably damaging	0.98
R2164:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R2260:Ptprk	UTSW	10	28206149	missense	possibly damaging	0.65
R2394:Ptprk	UTSW	10	28551717	missense	probably damaging	0.98
R2432:Ptprk	UTSW	10	28592844	missense	probably damaging	1.00
R2437:Ptprk	UTSW	10	28354713	missense	probably damaging	1.00
R2495:Ptprk	UTSW	10	28475078	splice site	probably benign
R3037:Ptprk	UTSW	10	28580478	missense	probably damaging	1.00
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3162:Ptprk	UTSW	10	28592826	missense	probably benign
R3687:Ptprk	UTSW	10	28473043	missense	probably damaging	1.00
R3722:Ptprk	UTSW	10	28383623	missense	probably damaging	1.00
R3892:Ptprk	UTSW	10	28263621	missense	probably benign	0.02
R3963:Ptprk	UTSW	10	28551665	missense	probably damaging	0.99
R4077:Ptprk	UTSW	10	28263512	missense	probably benign
R4079:Ptprk	UTSW	10	28263512	missense	probably benign
R4112:Ptprk	UTSW	10	28475288	critical splice donor site	probably null
R4255:Ptprk	UTSW	10	28206245	missense	probably benign	0.14
R4523:Ptprk	UTSW	10	28466052	missense	probably damaging	0.99
R4651:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4652:Ptprk	UTSW	10	28263690	missense	probably damaging	0.99
R4828:Ptprk	UTSW	10	28560054	missense	probably damaging	1.00
R4829:Ptprk	UTSW	10	28580484	nonsense	probably null
R4883:Ptprk	UTSW	10	28588932	missense	probably damaging	1.00
R5004:Ptprk	UTSW	10	28586063	missense	possibly damaging	0.95
R5013:Ptprk	UTSW	10	28551717	missense	probably damaging	0.99
R5092:Ptprk	UTSW	10	28592773	missense	probably damaging	1.00
R5126:Ptprk	UTSW	10	28575644	splice site	probably null
R5183:Ptprk	UTSW	10	28475236	missense	probably benign	0.02
R5264:Ptprk	UTSW	10	28585586	missense	probably damaging	1.00
R5304:Ptprk	UTSW	10	28592054	splice site	probably null
R5330:Ptprk	UTSW	10	28587080	missense	probably damaging	1.00
R5474:Ptprk	UTSW	10	28496930	nonsense	probably null
R5516:Ptprk	UTSW	10	28496930	nonsense	probably null
R5796:Ptprk	UTSW	10	28383575	missense	probably damaging	1.00
R5843:Ptprk	UTSW	10	28493064	missense	probably damaging	0.99
R5952:Ptprk	UTSW	10	28585675	missense	probably damaging	0.99
R6065:Ptprk	UTSW	10	28475170	missense	probably damaging	1.00
R6226:Ptprk	UTSW	10	28564103	missense	probably benign	0.02
R6264:Ptprk	UTSW	10	28566673	missense	probably damaging	1.00
R6638:Ptprk	UTSW	10	28595811	missense	probably damaging	1.00
R6843:Ptprk	UTSW	10	28591982	missense	possibly damaging	0.86
R6860:Ptprk	UTSW	10	28334484	missense	probably damaging	1.00
R6869:Ptprk	UTSW	10	28473059	critical splice donor site	probably null
R7214:Ptprk	UTSW	10	28574909	missense	probably benign	0.11
R7307:Ptprk	UTSW	10	28589008	nonsense	probably null
R7349:Ptprk	UTSW	10	28592838	missense	possibly damaging	0.85
R7442:Ptprk	UTSW	10	28574819	missense	probably damaging	1.00
R7585:Ptprk	UTSW	10	28560088	missense	probably damaging	1.00
R7661:Ptprk	UTSW	10	28466040	missense	probably benign	0.00
R7694:Ptprk	UTSW	10	28589370	missense	possibly damaging	0.63
R7740:Ptprk	UTSW	10	28496924	missense	probably damaging	1.00
R7810:Ptprk	UTSW	10	28592857	missense	probably damaging	0.97
R7831:Ptprk	UTSW	10	28568408	missense	possibly damaging	0.89
R7836:Ptprk	UTSW	10	28573389	missense	probably damaging	1.00
R8049:Ptprk	UTSW	10	28383569	missense	possibly damaging	0.84
R8235:Ptprk	UTSW	10	28589041	missense	possibly damaging	0.70
R8274:Ptprk	UTSW	10	28580412	missense	probably damaging	1.00
R8286:Ptprk	UTSW	10	28568327	missense	probably damaging	1.00
R8372:Ptprk	UTSW	10	28354692	missense	possibly damaging	0.78
R8727:Ptprk	UTSW	10	28566545	unclassified	probably benign
R8794:Ptprk	UTSW	10	28263508	nonsense	probably null
R8842:Ptprk	UTSW	10	28566501	missense	probably damaging	0.97
R8861:Ptprk	UTSW	10	28570190	missense	probably damaging	1.00
R8897:Ptprk	UTSW	10	28591957	missense	probably damaging	1.00
R8910:Ptprk	UTSW	10	28492997	missense	possibly damaging	0.68
R8976:Ptprk	UTSW	10	28585673	missense	probably damaging	1.00
R8982:Ptprk	UTSW	10	28560142	missense	probably damaging	1.00
R9036:Ptprk	UTSW	10	28585932	missense	probably benign	0.01
R9135:Ptprk	UTSW	10	28580417	missense	probably damaging	1.00
R9308:Ptprk	UTSW	10	28574854	missense	probably benign	0.15
R9317:Ptprk	UTSW	10	28354735	missense	probably damaging	0.96
Z1177:Ptprk	UTSW	10	28493120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAACGTCCCCTTTCTAGC -3'
(R):5'- AGTCCCCTCTTAACTACAGGTC -3'

Sequencing Primer
(F):5'- AGCTTCTTCTGCTAGGGTTAAG -3'
(R):5'- ACAGGTCTATTTGCAATCTTTGTTC -3'

Posted On

2021-08-02