Incidental Mutation 'R8919:Usp44'
ID 679140
Institutional Source Beutler Lab
Gene Symbol Usp44
Ensembl Gene ENSMUSG00000020020
Gene Name ubiquitin specific peptidase 44
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8919 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 93831555-93858088 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93857913 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 707 (N707K)
Ref Sequence ENSEMBL: ENSMUSP00000149020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047910] [ENSMUST00000180840] [ENSMUST00000181091] [ENSMUST00000181217] [ENSMUST00000181470] [ENSMUST00000216224]
AlphaFold Q8C2S0
Predicted Effect probably benign
Transcript: ENSMUST00000047910
SMART Domains Protein: ENSMUSP00000048285
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 167 466 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180392
Predicted Effect probably benign
Transcript: ENSMUST00000180840
SMART Domains Protein: ENSMUSP00000138006
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 167 466 2.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181091
SMART Domains Protein: ENSMUSP00000137904
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 144 443 2.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181217
SMART Domains Protein: ENSMUSP00000138083
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 177 476 2.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181470
SMART Domains Protein: ENSMUSP00000138050
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
Pfam:Peptidase_M24 1 97 6.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216224
AA Change: N707K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A C 17: 56,882,218 I209L probably benign Het
Aadat C T 8: 60,540,124 T373I possibly damaging Het
Abca13 T C 11: 9,291,653 L1172P possibly damaging Het
Abcg2 A G 6: 58,684,341 Y459C probably benign Het
AC125199.3 T C 16: 88,812,173 N4D possibly damaging Het
Acad8 A G 9: 26,999,489 M3T probably benign Het
Adcyap1r1 C T 6: 55,497,095 T472I probably damaging Het
Ank3 A T 10: 70,004,841 K1890N possibly damaging Het
Asic1 G A 15: 99,671,945 C49Y probably benign Het
Atp1a1 T C 3: 101,591,231 N215S probably damaging Het
C87436 A G 6: 86,445,792 Y116C probably damaging Het
Car5a T C 8: 121,944,780 D5G probably benign Het
Ccdc169 T C 3: 55,150,947 probably null Het
Ccdc93 A G 1: 121,499,241 R586G probably damaging Het
Cep295 A G 9: 15,326,711 V131A probably damaging Het
Cox5a A G 9: 57,529,046 D60G possibly damaging Het
Cpne6 A T 14: 55,512,647 E78D probably benign Het
Cyp2u1 T C 3: 131,295,465 E390G probably damaging Het
Dab2 C A 15: 6,435,790 N707K Het
Dock10 A T 1: 80,505,430 D2101E probably benign Het
Duoxa2 G A 2: 122,301,876 probably null Het
Eif4a3 T C 11: 119,299,932 D22G probably benign Het
Fam160a2 T C 7: 105,388,270 T369A possibly damaging Het
Fubp3 A G 2: 31,592,464 probably null Het
Gm10330 A G 12: 23,779,886 L98P probably benign Het
Gm5108 A G 5: 67,976,956 *102W probably null Het
Gpr149 A C 3: 62,531,057 S560A probably damaging Het
Haspin T C 11: 73,136,604 D553G probably benign Het
Hsf1 C T 15: 76,497,851 H104Y probably benign Het
Ifi203 T C 1: 173,928,928 T430A unknown Het
Itih2 G A 2: 10,098,011 Q771* probably null Het
Kazald1 T A 19: 45,076,956 L92Q probably damaging Het
Krt19 T C 11: 100,141,154 E324G probably damaging Het
Lrrc28 A T 7: 67,619,085 V79E possibly damaging Het
Ltn1 T A 16: 87,381,493 Q1616L probably damaging Het
Mdc1 A G 17: 35,847,951 K408E probably benign Het
Nalcn A T 14: 123,323,872 M738K probably benign Het
Ncoa4 T C 14: 32,172,891 L125P probably damaging Het
Ncor2 G T 5: 125,029,189 R810S Het
Neb C T 2: 52,237,129 G348D Het
Nfat5 T A 8: 107,368,596 F1156L probably damaging Het
Oit3 G A 10: 59,441,646 T13I unknown Het
Olfr1135 A C 2: 87,672,223 L48W probably damaging Het
Olfr1404 T C 1: 173,216,497 I282T probably damaging Het
Olfr490 A G 7: 108,287,082 F15L probably damaging Het
Olfr552 T A 7: 102,604,504 I50N probably damaging Het
Olfr785 G T 10: 129,410,213 M282I probably benign Het
Opa1 A C 16: 29,605,522 Q230P probably damaging Het
Papd7 G T 13: 69,503,709 T531N possibly damaging Het
Parpbp T C 10: 88,110,327 H410R probably null Het
Pex5l A G 3: 32,953,184 V481A probably damaging Het
Plekhh3 C A 11: 101,166,399 R344L probably benign Het
Prrc2b T C 2: 32,214,941 V1477A probably benign Het
Ptp4a2 G A 4: 129,845,152 G94S possibly damaging Het
Ptprk T A 10: 28,483,207 Y598* probably null Het
Rfx5 C A 3: 94,957,164 T207N probably damaging Het
Rnase2b A G 14: 51,162,890 T143A possibly damaging Het
Scn1a A G 2: 66,337,986 V92A probably benign Het
Shank2 C A 7: 144,411,528 P958T probably damaging Het
Slc13a1 A G 6: 24,108,195 I294T probably damaging Het
Slc4a8 A T 15: 100,814,540 E1084D probably benign Het
Smurf1 T A 5: 144,883,612 R549* probably null Het
Sprr2b T C 3: 92,317,725 C93R unknown Het
Tcn2 G T 11: 3,923,569 S259Y probably damaging Het
Tex43 T C 18: 56,592,465 F66L probably damaging Het
Tle1 A G 4: 72,158,288 S168P possibly damaging Het
Tnfrsf1b C T 4: 145,223,580 G264D probably damaging Het
Tnks2 T A 19: 36,845,688 N118K probably damaging Het
Topaz1 G T 9: 122,797,865 probably benign Het
Traf3ip1 A G 1: 91,516,074 probably benign Het
Ttk A G 9: 83,839,269 E69G probably damaging Het
Tulp3 T C 6: 128,334,003 D87G probably benign Het
Usp38 C T 8: 80,981,850 G1033D probably damaging Het
Vipas39 T A 12: 87,259,084 R112* probably null Het
Vmn1r185 A C 7: 26,611,781 S100A probably damaging Het
Vmn1r209 T C 13: 22,806,053 M156V probably benign Het
Vmn1r3 G A 4: 3,184,863 T148I probably benign Het
Wdr41 G A 13: 95,015,112 R260H probably benign Het
Wdr90 G A 17: 25,857,172 R104C Het
Wnk2 A T 13: 49,068,235 H1183Q possibly damaging Het
Zfp667 A T 7: 6,305,257 H308L possibly damaging Het
Zfp952 A G 17: 33,001,654 N18D possibly damaging Het
Other mutations in Usp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Usp44 UTSW 10 93845655 start gained probably benign
R0497:Usp44 UTSW 10 93846806 missense possibly damaging 0.77
R0789:Usp44 UTSW 10 93847220 intron probably benign
R1521:Usp44 UTSW 10 93847186 nonsense probably null
R4032:Usp44 UTSW 10 93847265 intron probably benign
R4212:Usp44 UTSW 10 93846770 missense possibly damaging 0.55
R4755:Usp44 UTSW 10 93846906 missense probably damaging 1.00
R4764:Usp44 UTSW 10 93846071 missense probably benign 0.17
R5095:Usp44 UTSW 10 93846845 missense possibly damaging 0.70
R5775:Usp44 UTSW 10 93845978 missense possibly damaging 0.80
R6029:Usp44 UTSW 10 93846632 missense probably damaging 0.96
R6193:Usp44 UTSW 10 93847148 intron probably benign
R6233:Usp44 UTSW 10 93850340 missense probably damaging 1.00
R6338:Usp44 UTSW 10 93846513 missense probably damaging 1.00
R6374:Usp44 UTSW 10 93856310 missense probably benign 0.12
R6556:Usp44 UTSW 10 93846008 missense probably benign 0.20
R6615:Usp44 UTSW 10 93846489 missense possibly damaging 0.48
R7099:Usp44 UTSW 10 93850187 missense possibly damaging 0.95
R7224:Usp44 UTSW 10 93845993 missense probably benign 0.08
R7361:Usp44 UTSW 10 93846468 missense probably benign 0.00
R7576:Usp44 UTSW 10 93846428 missense probably damaging 0.99
R8014:Usp44 UTSW 10 93852709 critical splice acceptor site probably null
R8695:Usp44 UTSW 10 93846503 missense probably damaging 1.00
R8950:Usp44 UTSW 10 93846267 missense possibly damaging 0.93
R9144:Usp44 UTSW 10 93845783 missense probably benign 0.09
R9254:Usp44 UTSW 10 93852773 missense possibly damaging 0.93
R9379:Usp44 UTSW 10 93852773 missense possibly damaging 0.93
R9488:Usp44 UTSW 10 93846989 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCAACGATTCCAAGCTGAGC -3'
(R):5'- GATGCCACCTGAATTTCTTTAGTAG -3'

Sequencing Primer
(F):5'- ATTCCAAGCTGAGCATGTGC -3'
(R):5'- CCACCTGAATTTCTTTAGTAGATTGC -3'
Posted On 2021-08-02