Incidental Mutation 'R8919:Usp44'
ID 679140
Institutional Source Beutler Lab
Gene Symbol Usp44
Ensembl Gene ENSMUSG00000020020
Gene Name ubiquitin specific peptidase 44
Synonyms E430004F17Rik
MMRRC Submission 068706-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8919 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 93667417-93693950 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93693775 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 707 (N707K)
Ref Sequence ENSEMBL: ENSMUSP00000149020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047910] [ENSMUST00000180840] [ENSMUST00000181091] [ENSMUST00000181217] [ENSMUST00000181470] [ENSMUST00000216224]
AlphaFold Q8C2S0
Predicted Effect probably benign
Transcript: ENSMUST00000047910
SMART Domains Protein: ENSMUSP00000048285
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 167 466 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180392
Predicted Effect probably benign
Transcript: ENSMUST00000180840
SMART Domains Protein: ENSMUSP00000138006
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 167 466 2.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181091
SMART Domains Protein: ENSMUSP00000137904
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 144 443 2.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181217
SMART Domains Protein: ENSMUSP00000138083
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
low complexity region 77 108 N/A INTRINSIC
Pfam:Peptidase_M24 177 476 2.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181470
SMART Domains Protein: ENSMUSP00000138050
Gene: ENSMUSG00000036112

DomainStartEndE-ValueType
Pfam:Peptidase_M24 1 97 6.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216224
AA Change: N707K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat C T 8: 60,993,158 (GRCm39) T373I possibly damaging Het
Abca13 T C 11: 9,241,653 (GRCm39) L1172P possibly damaging Het
Abcg2 A G 6: 58,661,326 (GRCm39) Y459C probably benign Het
AC125199.3 T C 16: 88,609,061 (GRCm39) N4D possibly damaging Het
Acad8 A G 9: 26,910,785 (GRCm39) M3T probably benign Het
Acsbg3 A C 17: 57,189,218 (GRCm39) I209L probably benign Het
Adcyap1r1 C T 6: 55,474,080 (GRCm39) T472I probably damaging Het
Ank3 A T 10: 69,840,671 (GRCm39) K1890N possibly damaging Het
Asic1 G A 15: 99,569,826 (GRCm39) C49Y probably benign Het
Atp1a1 T C 3: 101,498,547 (GRCm39) N215S probably damaging Het
C87436 A G 6: 86,422,774 (GRCm39) Y116C probably damaging Het
Car5a T C 8: 122,671,519 (GRCm39) D5G probably benign Het
Ccdc169 T C 3: 55,058,368 (GRCm39) probably null Het
Ccdc93 A G 1: 121,426,970 (GRCm39) R586G probably damaging Het
Cep295 A G 9: 15,238,007 (GRCm39) V131A probably damaging Het
Cox5a A G 9: 57,436,329 (GRCm39) D60G possibly damaging Het
Cpne6 A T 14: 55,750,104 (GRCm39) E78D probably benign Het
Cyp2u1 T C 3: 131,089,114 (GRCm39) E390G probably damaging Het
Dab2 C A 15: 6,465,271 (GRCm39) N707K Het
Dock10 A T 1: 80,483,147 (GRCm39) D2101E probably benign Het
Duoxa2 G A 2: 122,132,357 (GRCm39) probably null Het
Eif4a3 T C 11: 119,190,758 (GRCm39) D22G probably benign Het
Fhip1b T C 7: 105,037,477 (GRCm39) T369A possibly damaging Het
Fubp3 A G 2: 31,482,476 (GRCm39) probably null Het
Gm10330 A G 12: 23,829,887 (GRCm39) L98P probably benign Het
Gm5108 A G 5: 68,134,299 (GRCm39) *102W probably null Het
Gpr149 A C 3: 62,438,478 (GRCm39) S560A probably damaging Het
Haspin T C 11: 73,027,430 (GRCm39) D553G probably benign Het
Hsf1 C T 15: 76,382,051 (GRCm39) H104Y probably benign Het
Ifi203 T C 1: 173,756,494 (GRCm39) T430A unknown Het
Itih2 G A 2: 10,102,822 (GRCm39) Q771* probably null Het
Kazald1 T A 19: 45,065,395 (GRCm39) L92Q probably damaging Het
Krt19 T C 11: 100,031,980 (GRCm39) E324G probably damaging Het
Lrrc28 A T 7: 67,268,833 (GRCm39) V79E possibly damaging Het
Ltn1 T A 16: 87,178,381 (GRCm39) Q1616L probably damaging Het
Mdc1 A G 17: 36,158,843 (GRCm39) K408E probably benign Het
Nalcn A T 14: 123,561,284 (GRCm39) M738K probably benign Het
Ncoa4 T C 14: 31,894,848 (GRCm39) L125P probably damaging Het
Ncor2 G T 5: 125,106,253 (GRCm39) R810S Het
Neb C T 2: 52,127,141 (GRCm39) G348D Het
Nfat5 T A 8: 108,095,228 (GRCm39) F1156L probably damaging Het
Oit3 G A 10: 59,277,468 (GRCm39) T13I unknown Het
Opa1 A C 16: 29,424,340 (GRCm39) Q230P probably damaging Het
Or10j3b T C 1: 173,044,064 (GRCm39) I282T probably damaging Het
Or52k2 T A 7: 102,253,711 (GRCm39) I50N probably damaging Het
Or5p66 A G 7: 107,886,289 (GRCm39) F15L probably damaging Het
Or5w12 A C 2: 87,502,567 (GRCm39) L48W probably damaging Het
Or6c5b G T 10: 129,246,082 (GRCm39) M282I probably benign Het
Parpbp T C 10: 87,946,189 (GRCm39) H410R probably null Het
Pex5l A G 3: 33,007,333 (GRCm39) V481A probably damaging Het
Plekhh3 C A 11: 101,057,225 (GRCm39) R344L probably benign Het
Prrc2b T C 2: 32,104,953 (GRCm39) V1477A probably benign Het
Ptp4a2 G A 4: 129,738,945 (GRCm39) G94S possibly damaging Het
Ptprk T A 10: 28,359,203 (GRCm39) Y598* probably null Het
Rfx5 C A 3: 94,864,475 (GRCm39) T207N probably damaging Het
Rnase2b A G 14: 51,400,347 (GRCm39) T143A possibly damaging Het
Scn1a A G 2: 66,168,330 (GRCm39) V92A probably benign Het
Shank2 C A 7: 143,965,265 (GRCm39) P958T probably damaging Het
Slc13a1 A G 6: 24,108,194 (GRCm39) I294T probably damaging Het
Slc4a8 A T 15: 100,712,421 (GRCm39) E1084D probably benign Het
Smurf1 T A 5: 144,820,422 (GRCm39) R549* probably null Het
Spmip10 T C 18: 56,725,537 (GRCm39) F66L probably damaging Het
Sprr2b T C 3: 92,225,032 (GRCm39) C93R unknown Het
Tcn2 G T 11: 3,873,569 (GRCm39) S259Y probably damaging Het
Tent4a G T 13: 69,651,828 (GRCm39) T531N possibly damaging Het
Tle1 A G 4: 72,076,525 (GRCm39) S168P possibly damaging Het
Tnfrsf1b C T 4: 144,950,150 (GRCm39) G264D probably damaging Het
Tnks2 T A 19: 36,823,088 (GRCm39) N118K probably damaging Het
Topaz1 G T 9: 122,626,930 (GRCm39) probably benign Het
Traf3ip1 A G 1: 91,443,796 (GRCm39) probably benign Het
Ttk A G 9: 83,721,322 (GRCm39) E69G probably damaging Het
Tulp3 T C 6: 128,310,966 (GRCm39) D87G probably benign Het
Usp38 C T 8: 81,708,479 (GRCm39) G1033D probably damaging Het
Vipas39 T A 12: 87,305,858 (GRCm39) R112* probably null Het
Vmn1r185 A C 7: 26,311,206 (GRCm39) S100A probably damaging Het
Vmn1r209 T C 13: 22,990,223 (GRCm39) M156V probably benign Het
Vmn1r3 G A 4: 3,184,863 (GRCm39) T148I probably benign Het
Wdr41 G A 13: 95,151,620 (GRCm39) R260H probably benign Het
Wdr90 G A 17: 26,076,146 (GRCm39) R104C Het
Wnk2 A T 13: 49,221,711 (GRCm39) H1183Q possibly damaging Het
Zfp667 A T 7: 6,308,256 (GRCm39) H308L possibly damaging Het
Zfp952 A G 17: 33,220,628 (GRCm39) N18D possibly damaging Het
Other mutations in Usp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Usp44 UTSW 10 93,681,517 (GRCm39) start gained probably benign
R0497:Usp44 UTSW 10 93,682,668 (GRCm39) missense possibly damaging 0.77
R0789:Usp44 UTSW 10 93,683,082 (GRCm39) intron probably benign
R1521:Usp44 UTSW 10 93,683,048 (GRCm39) nonsense probably null
R4032:Usp44 UTSW 10 93,683,127 (GRCm39) intron probably benign
R4212:Usp44 UTSW 10 93,682,632 (GRCm39) missense possibly damaging 0.55
R4755:Usp44 UTSW 10 93,682,768 (GRCm39) missense probably damaging 1.00
R4764:Usp44 UTSW 10 93,681,933 (GRCm39) missense probably benign 0.17
R5095:Usp44 UTSW 10 93,682,707 (GRCm39) missense possibly damaging 0.70
R5775:Usp44 UTSW 10 93,681,840 (GRCm39) missense possibly damaging 0.80
R6029:Usp44 UTSW 10 93,682,494 (GRCm39) missense probably damaging 0.96
R6193:Usp44 UTSW 10 93,683,010 (GRCm39) intron probably benign
R6233:Usp44 UTSW 10 93,686,202 (GRCm39) missense probably damaging 1.00
R6338:Usp44 UTSW 10 93,682,375 (GRCm39) missense probably damaging 1.00
R6374:Usp44 UTSW 10 93,692,172 (GRCm39) missense probably benign 0.12
R6556:Usp44 UTSW 10 93,681,870 (GRCm39) missense probably benign 0.20
R6615:Usp44 UTSW 10 93,682,351 (GRCm39) missense possibly damaging 0.48
R7099:Usp44 UTSW 10 93,686,049 (GRCm39) missense possibly damaging 0.95
R7224:Usp44 UTSW 10 93,681,855 (GRCm39) missense probably benign 0.08
R7361:Usp44 UTSW 10 93,682,330 (GRCm39) missense probably benign 0.00
R7576:Usp44 UTSW 10 93,682,290 (GRCm39) missense probably damaging 0.99
R8014:Usp44 UTSW 10 93,688,571 (GRCm39) critical splice acceptor site probably null
R8695:Usp44 UTSW 10 93,682,365 (GRCm39) missense probably damaging 1.00
R8950:Usp44 UTSW 10 93,682,129 (GRCm39) missense possibly damaging 0.93
R9144:Usp44 UTSW 10 93,681,645 (GRCm39) missense probably benign 0.09
R9254:Usp44 UTSW 10 93,688,635 (GRCm39) missense possibly damaging 0.93
R9379:Usp44 UTSW 10 93,688,635 (GRCm39) missense possibly damaging 0.93
R9488:Usp44 UTSW 10 93,682,851 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCAACGATTCCAAGCTGAGC -3'
(R):5'- GATGCCACCTGAATTTCTTTAGTAG -3'

Sequencing Primer
(F):5'- ATTCCAAGCTGAGCATGTGC -3'
(R):5'- CCACCTGAATTTCTTTAGTAGATTGC -3'
Posted On 2021-08-02