Incidental Mutation 'R8919:Nalcn'
ID 679157
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Name sodium leak channel, non-selective
Synonyms A530023G15Rik, Vgcnl1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8919 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 123276634-123627144 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123323872 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 738 (M738K)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000000201
AA Change: M738K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: M738K

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Meta Mutation Damage Score 0.0816 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A C 17: 56,882,218 I209L probably benign Het
Aadat C T 8: 60,540,124 T373I possibly damaging Het
Abca13 T C 11: 9,291,653 L1172P possibly damaging Het
Abcg2 A G 6: 58,684,341 Y459C probably benign Het
AC125199.3 T C 16: 88,812,173 N4D possibly damaging Het
Acad8 A G 9: 26,999,489 M3T probably benign Het
Adcyap1r1 C T 6: 55,497,095 T472I probably damaging Het
Ank3 A T 10: 70,004,841 K1890N possibly damaging Het
Asic1 G A 15: 99,671,945 C49Y probably benign Het
Atp1a1 T C 3: 101,591,231 N215S probably damaging Het
C87436 A G 6: 86,445,792 Y116C probably damaging Het
Car5a T C 8: 121,944,780 D5G probably benign Het
Ccdc169 T C 3: 55,150,947 probably null Het
Ccdc93 A G 1: 121,499,241 R586G probably damaging Het
Cep295 A G 9: 15,326,711 V131A probably damaging Het
Cox5a A G 9: 57,529,046 D60G possibly damaging Het
Cpne6 A T 14: 55,512,647 E78D probably benign Het
Cyp2u1 T C 3: 131,295,465 E390G probably damaging Het
Dab2 C A 15: 6,435,790 N707K Het
Dock10 A T 1: 80,505,430 D2101E probably benign Het
Duoxa2 G A 2: 122,301,876 probably null Het
Eif4a3 T C 11: 119,299,932 D22G probably benign Het
Fam160a2 T C 7: 105,388,270 T369A possibly damaging Het
Fubp3 A G 2: 31,592,464 probably null Het
Gm10330 A G 12: 23,779,886 L98P probably benign Het
Gm5108 A G 5: 67,976,956 *102W probably null Het
Gpr149 A C 3: 62,531,057 S560A probably damaging Het
Haspin T C 11: 73,136,604 D553G probably benign Het
Hsf1 C T 15: 76,497,851 H104Y probably benign Het
Ifi203 T C 1: 173,928,928 T430A unknown Het
Itih2 G A 2: 10,098,011 Q771* probably null Het
Kazald1 T A 19: 45,076,956 L92Q probably damaging Het
Krt19 T C 11: 100,141,154 E324G probably damaging Het
Lrrc28 A T 7: 67,619,085 V79E possibly damaging Het
Ltn1 T A 16: 87,381,493 Q1616L probably damaging Het
Mdc1 A G 17: 35,847,951 K408E probably benign Het
Ncoa4 T C 14: 32,172,891 L125P probably damaging Het
Ncor2 G T 5: 125,029,189 R810S Het
Neb C T 2: 52,237,129 G348D Het
Nfat5 T A 8: 107,368,596 F1156L probably damaging Het
Oit3 G A 10: 59,441,646 T13I unknown Het
Olfr1135 A C 2: 87,672,223 L48W probably damaging Het
Olfr1404 T C 1: 173,216,497 I282T probably damaging Het
Olfr490 A G 7: 108,287,082 F15L probably damaging Het
Olfr552 T A 7: 102,604,504 I50N probably damaging Het
Olfr785 G T 10: 129,410,213 M282I probably benign Het
Opa1 A C 16: 29,605,522 Q230P probably damaging Het
Papd7 G T 13: 69,503,709 T531N possibly damaging Het
Parpbp T C 10: 88,110,327 H410R probably null Het
Pex5l A G 3: 32,953,184 V481A probably damaging Het
Plekhh3 C A 11: 101,166,399 R344L probably benign Het
Prrc2b T C 2: 32,214,941 V1477A probably benign Het
Ptp4a2 G A 4: 129,845,152 G94S possibly damaging Het
Ptprk T A 10: 28,483,207 Y598* probably null Het
Rfx5 C A 3: 94,957,164 T207N probably damaging Het
Rnase2b A G 14: 51,162,890 T143A possibly damaging Het
Scn1a A G 2: 66,337,986 V92A probably benign Het
Shank2 C A 7: 144,411,528 P958T probably damaging Het
Slc13a1 A G 6: 24,108,195 I294T probably damaging Het
Slc4a8 A T 15: 100,814,540 E1084D probably benign Het
Smurf1 T A 5: 144,883,612 R549* probably null Het
Sprr2b T C 3: 92,317,725 C93R unknown Het
Tcn2 G T 11: 3,923,569 S259Y probably damaging Het
Tex43 T C 18: 56,592,465 F66L probably damaging Het
Tle1 A G 4: 72,158,288 S168P possibly damaging Het
Tnfrsf1b C T 4: 145,223,580 G264D probably damaging Het
Tnks2 T A 19: 36,845,688 N118K probably damaging Het
Topaz1 G T 9: 122,797,865 probably benign Het
Traf3ip1 A G 1: 91,516,074 probably benign Het
Ttk A G 9: 83,839,269 E69G probably damaging Het
Tulp3 T C 6: 128,334,003 D87G probably benign Het
Usp38 C T 8: 80,981,850 G1033D probably damaging Het
Usp44 T A 10: 93,857,913 N707K probably benign Het
Vipas39 T A 12: 87,259,084 R112* probably null Het
Vmn1r185 A C 7: 26,611,781 S100A probably damaging Het
Vmn1r209 T C 13: 22,806,053 M156V probably benign Het
Vmn1r3 G A 4: 3,184,863 T148I probably benign Het
Wdr41 G A 13: 95,015,112 R260H probably benign Het
Wdr90 G A 17: 25,857,172 R104C Het
Wnk2 A T 13: 49,068,235 H1183Q possibly damaging Het
Zfp667 A T 7: 6,305,257 H308L possibly damaging Het
Zfp952 A G 17: 33,001,654 N18D possibly damaging Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123348789 missense probably benign 0.00
IGL00964:Nalcn APN 14 123295384 splice site probably benign
IGL01310:Nalcn APN 14 123317249 missense probably benign 0.00
IGL01578:Nalcn APN 14 123572091 missense probably benign 0.00
IGL01925:Nalcn APN 14 123291848 missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123323358 missense probably benign 0.05
IGL02096:Nalcn APN 14 123594503 missense probably benign 0.11
IGL02212:Nalcn APN 14 123515330 missense probably damaging 0.99
IGL02306:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02471:Nalcn APN 14 123323314 missense probably benign 0.02
IGL02478:Nalcn APN 14 123321305 missense probably benign 0.26
IGL02551:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02630:Nalcn APN 14 123317879 missense probably benign 0.16
IGL02632:Nalcn APN 14 123317853 missense probably benign 0.11
IGL02661:Nalcn APN 14 123592909 splice site probably benign
IGL02830:Nalcn APN 14 123293469 missense probably damaging 0.98
IGL02939:Nalcn APN 14 123298872 missense probably null 1.00
IGL03035:Nalcn APN 14 123278218 nonsense probably null
IGL03226:Nalcn APN 14 123281115 missense probably benign 0.00
IGL03242:Nalcn APN 14 123321487 missense possibly damaging 0.91
Narnia UTSW 14 123291047 missense probably benign 0.11
R0019:Nalcn UTSW 14 123507489 missense probably benign 0.18
R0144:Nalcn UTSW 14 123371536 missense probably damaging 0.96
R0144:Nalcn UTSW 14 123409839 splice site probably benign
R0359:Nalcn UTSW 14 123299168 missense probably damaging 1.00
R0383:Nalcn UTSW 14 123507559 missense probably benign 0.01
R0400:Nalcn UTSW 14 123290960 splice site probably benign
R0467:Nalcn UTSW 14 123291047 missense probably benign 0.11
R0506:Nalcn UTSW 14 123596614 missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123294343 missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123299141 splice site probably benign
R0624:Nalcn UTSW 14 123370032 missense probably benign
R0883:Nalcn UTSW 14 123464740 missense probably damaging 1.00
R1381:Nalcn UTSW 14 123314105 missense probably damaging 1.00
R1467:Nalcn UTSW 14 123464656 splice site probably benign
R1689:Nalcn UTSW 14 123285254 missense probably damaging 1.00
R1726:Nalcn UTSW 14 123308404 missense probably damaging 1.00
R1774:Nalcn UTSW 14 123278266 missense probably benign
R1854:Nalcn UTSW 14 123460412 missense probably damaging 1.00
R1869:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123283601 missense probably benign 0.00
R1899:Nalcn UTSW 14 123316126 missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123302769 missense probably benign 0.08
R2016:Nalcn UTSW 14 123594581 splice site probably null
R2034:Nalcn UTSW 14 123283603 missense probably benign 0.01
R2087:Nalcn UTSW 14 123281145 missense probably benign
R2149:Nalcn UTSW 14 123370017 missense probably benign 0.01
R2157:Nalcn UTSW 14 123409752 missense probably benign 0.32
R2166:Nalcn UTSW 14 123369951 missense probably benign 0.00
R2932:Nalcn UTSW 14 123593018 missense probably benign 0.06
R3408:Nalcn UTSW 14 123596617 missense probably null 0.98
R3778:Nalcn UTSW 14 123464716 missense probably damaging 1.00
R3807:Nalcn UTSW 14 123278187 missense probably damaging 1.00
R3835:Nalcn UTSW 14 123293422 splice site probably benign
R3937:Nalcn UTSW 14 123369945 missense probably benign 0.00
R4001:Nalcn UTSW 14 123596594 missense probably damaging 1.00
R4015:Nalcn UTSW 14 123486387 missense probably damaging 1.00
R4033:Nalcn UTSW 14 123599989 splice site probably benign
R4231:Nalcn UTSW 14 123599913 missense probably benign 0.01
R4464:Nalcn UTSW 14 123323350 missense probably benign
R4512:Nalcn UTSW 14 123295448 missense probably damaging 1.00
R4542:Nalcn UTSW 14 123321477 synonymous silent
R4557:Nalcn UTSW 14 123321235 intron probably benign
R4869:Nalcn UTSW 14 123599884 missense probably benign 0.44
R5083:Nalcn UTSW 14 123323294 splice site probably null
R5109:Nalcn UTSW 14 123278238 missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123515770 missense probably damaging 0.98
R5158:Nalcn UTSW 14 123515737 missense probably damaging 1.00
R5259:Nalcn UTSW 14 123515651 missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123515365 missense probably damaging 1.00
R5514:Nalcn UTSW 14 123283711 missense probably benign 0.14
R5523:Nalcn UTSW 14 123409743 missense probably damaging 1.00
R5551:Nalcn UTSW 14 123278286 missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5671:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5750:Nalcn UTSW 14 123572038 missense probably benign
R5765:Nalcn UTSW 14 123464726 missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123409749 missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123317843 missense probably benign 0.00
R6558:Nalcn UTSW 14 123486507 missense probably benign
R6631:Nalcn UTSW 14 123460251 missense probably benign 0.17
R6667:Nalcn UTSW 14 123321323 missense probably damaging 1.00
R6670:Nalcn UTSW 14 123464672 missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123298067 missense probably damaging 0.99
R6731:Nalcn UTSW 14 123599934 missense probably benign 0.22
R6957:Nalcn UTSW 14 123507554 missense probably damaging 0.96
R6970:Nalcn UTSW 14 123314094 missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123293465 missense probably damaging 1.00
R7018:Nalcn UTSW 14 123409821 missense probably damaging 1.00
R7040:Nalcn UTSW 14 123287855 missense probably benign
R7089:Nalcn UTSW 14 123278349 missense probably benign 0.01
R7128:Nalcn UTSW 14 123594502 missense probably damaging 0.99
R7149:Nalcn UTSW 14 123599865 missense probably benign 0.02
R7361:Nalcn UTSW 14 123291839 missense probably benign 0.00
R7378:Nalcn UTSW 14 123302890 missense probably damaging 1.00
R7408:Nalcn UTSW 14 123291860 missense probably benign 0.00
R7470:Nalcn UTSW 14 123572044 missense probably benign 0.09
R7483:Nalcn UTSW 14 123314087 missense probably damaging 1.00
R7521:Nalcn UTSW 14 123293458 missense probably damaging 1.00
R7558:Nalcn UTSW 14 123486385 critical splice donor site probably null
R7585:Nalcn UTSW 14 123515638 missense probably damaging 1.00
R7591:Nalcn UTSW 14 123323885 missense probably benign 0.01
R7761:Nalcn UTSW 14 123294379 missense probably damaging 1.00
R7761:Nalcn UTSW 14 123294380 missense probably damaging 1.00
R7811:Nalcn UTSW 14 123298945 missense probably damaging 1.00
R7983:Nalcn UTSW 14 123592997 missense probably benign 0.17
R8089:Nalcn UTSW 14 123299960 missense probably damaging 1.00
R8110:Nalcn UTSW 14 123464701 missense probably benign 0.00
R8190:Nalcn UTSW 14 123599939 missense possibly damaging 0.69
R8273:Nalcn UTSW 14 123317024 missense probably damaging 1.00
R8407:Nalcn UTSW 14 123317271 missense probably damaging 1.00
R8497:Nalcn UTSW 14 123515359 missense probably damaging 1.00
R8544:Nalcn UTSW 14 123371523 missense probably benign 0.40
R8549:Nalcn UTSW 14 123370036 missense probably benign 0.01
R8731:Nalcn UTSW 14 123599854 missense probably benign 0.01
R8862:Nalcn UTSW 14 123409787 missense possibly damaging 0.96
R9072:Nalcn UTSW 14 123295451 missense possibly damaging 0.66
R9073:Nalcn UTSW 14 123295451 missense possibly damaging 0.66
R9182:Nalcn UTSW 14 123596604 missense probably damaging 1.00
R9193:Nalcn UTSW 14 123308380 nonsense probably null
R9241:Nalcn UTSW 14 123572017 missense probably benign 0.00
R9267:Nalcn UTSW 14 123281155 missense probably benign 0.08
R9274:Nalcn UTSW 14 123515656 missense probably damaging 1.00
R9277:Nalcn UTSW 14 123281111 missense probably damaging 0.98
R9376:Nalcn UTSW 14 123278301 missense possibly damaging 0.74
X0060:Nalcn UTSW 14 123285241 missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123294445 missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123594568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAACCTAGGTCCTCACC -3'
(R):5'- AGCTCCTCTTGGTCTTGGAC -3'

Sequencing Primer
(F):5'- AGGTCCTCACCATGCCTG -3'
(R):5'- GACTTCTGCTTTGTGTTTCTGAC -3'
Posted On 2021-08-02