Incidental Mutation 'R8920:Gm10093'
ID 679216
Institutional Source Beutler Lab
Gene Symbol Gm10093
Ensembl Gene ENSMUSG00000061062
Gene Name predicted pseudogene 10093
Synonyms EG15181
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock # R8920 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 78491565-78493541 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78491742 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 54 (Y54C)
Ref Sequence ENSEMBL: ENSMUSP00000078339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079363]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000079363
AA Change: Y54C

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078339
Gene: ENSMUSG00000061062
AA Change: Y54C

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 18 320 3.2e-84 PFAM
low complexity region 390 402 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 443 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa10 T A 8: 62,074,546 Q160L probably benign Het
Apc2 A T 10: 80,314,100 I1663L probably benign Het
Bahcc1 C G 11: 120,284,505 R1802G probably damaging Het
C1qtnf1 T C 11: 118,448,242 V246A possibly damaging Het
Cbl A G 9: 44,167,273 M267T probably damaging Het
Cd300lf T C 11: 115,126,354 K48E probably benign Het
Cfap46 G T 7: 139,652,526 N840K Het
Cfap54 T A 10: 92,940,337 probably null Het
Cnrip1 A C 11: 17,055,003 K184N unknown Het
Dnah11 A T 12: 118,113,939 L1273Q probably damaging Het
Dyrk1a T G 16: 94,659,629 I48R probably benign Het
Exoc7 T C 11: 116,289,229 E683G probably benign Het
Igtp A T 11: 58,206,173 I57F probably damaging Het
Inhbb T C 1: 119,417,377 N394S probably damaging Het
Jag1 T C 2: 137,089,223 H663R probably benign Het
Kcna6 A G 6: 126,739,647 F93S probably damaging Het
L1td1 C A 4: 98,736,627 S353* probably null Het
Lgals12 T C 19: 7,598,801 I253V possibly damaging Het
Lgals4 C T 7: 28,840,864 R195C probably benign Het
Lrp1b A T 2: 42,323,598 D67E Het
Lrrc43 T C 5: 123,501,131 S408P probably benign Het
Madd T C 2: 91,176,823 I315V probably benign Het
Mdn1 T C 4: 32,719,280 F2281S probably damaging Het
Med13l A T 5: 118,747,478 K1499* probably null Het
Myoc A G 1: 162,647,558 E226G probably benign Het
Nmur1 T C 1: 86,387,855 Y96C probably damaging Het
Nwd2 A T 5: 63,791,520 D145V probably damaging Het
Olfr830 C A 9: 18,876,098 T254K probably damaging Het
Paqr8 A T 1: 20,935,021 Q133L probably damaging Het
Plbd2 T C 5: 120,492,850 D230G probably damaging Het
Plekha7 A G 7: 116,144,983 I694T probably benign Het
Rnf139 C T 15: 58,899,680 T518I possibly damaging Het
Ryr1 G T 7: 29,090,215 S1498R possibly damaging Het
Senp6 T A 9: 80,092,279 S72T probably benign Het
Slc12a7 C T 13: 73,798,449 P554S probably damaging Het
Slc6a2 C A 8: 92,961,362 R39S probably benign Het
Snrpe T G 1: 133,606,461 H88P probably benign Het
Stard9 T A 2: 120,702,607 V3115E probably damaging Het
Stk39 C T 2: 68,471,847 V11I unknown Het
Tapbpl T C 6: 125,228,251 Y244C probably damaging Het
Tpx2 A G 2: 152,884,294 E393G probably damaging Het
Vmn2r100 A T 17: 19,521,358 N111Y probably damaging Het
Vstm4 C T 14: 32,863,658 R61C probably damaging Het
Washc2 T A 6: 116,244,654 F698I possibly damaging Het
Zfp467 G A 6: 48,438,480 P413S probably benign Het
Zfp532 G T 18: 65,687,319 A992S probably benign Het
Zfp622 G A 15: 25,996,235 W430* probably null Het
Other mutations in Gm10093
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Gm10093 APN 17 78492129 missense probably damaging 1.00
IGL01983:Gm10093 APN 17 78492853 missense probably benign
IGL02543:Gm10093 APN 17 78491874 missense probably damaging 0.97
buttress UTSW 17 78492914 missense possibly damaging 0.91
Chartre UTSW 17 78492540 missense probably damaging 0.99
R1174:Gm10093 UTSW 17 78492078 missense probably benign 0.01
R1605:Gm10093 UTSW 17 78492108 missense probably damaging 0.98
R2416:Gm10093 UTSW 17 78492516 missense probably damaging 1.00
R2919:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R2920:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R3846:Gm10093 UTSW 17 78492972 missense possibly damaging 0.91
R4544:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R4546:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R5223:Gm10093 UTSW 17 78492438 missense probably benign 0.02
R5297:Gm10093 UTSW 17 78492758 missense probably benign
R6164:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
R6568:Gm10093 UTSW 17 78492588 missense probably damaging 1.00
R6726:Gm10093 UTSW 17 78492858 missense probably damaging 0.99
R6901:Gm10093 UTSW 17 78492660 missense probably benign 0.07
R6923:Gm10093 UTSW 17 78492914 missense possibly damaging 0.91
R7838:Gm10093 UTSW 17 78492018 missense probably damaging 1.00
R8002:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
R8728:Gm10093 UTSW 17 78492903 missense probably benign 0.01
R8821:Gm10093 UTSW 17 78492540 missense probably damaging 0.99
X0060:Gm10093 UTSW 17 78492128 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGCAAGATGGCGCAGACTC -3'
(R):5'- GATGTCCGTCTGCTGCTTATTAAG -3'

Sequencing Primer
(F):5'- ATGGCGCAGACTCAGGGC -3'
(R):5'- CTCCTGTGGACAACTGACAG -3'
Posted On 2021-08-02