Incidental Mutation 'R8921:Akr1b3'
ID 679245
Institutional Source Beutler Lab
Gene Symbol Akr1b3
Ensembl Gene ENSMUSG00000001642
Gene Name aldo-keto reductase family 1, member B3 (aldose reductase)
Synonyms Ahr-1, Aldor1, Ahr1, ALR2, Aldr1, AR
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock # R8921 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34302434-34317478 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34312704 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 57 (V57E)
Ref Sequence ENSEMBL: ENSMUSP00000100045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102980] [ENSMUST00000154655]
AlphaFold P45376
Predicted Effect probably benign
Transcript: ENSMUST00000102980
AA Change: V57E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100045
Gene: ENSMUSG00000001642
AA Change: V57E

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 13 294 4.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154655
AA Change: V80E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000114391
Gene: ENSMUSG00000001642
AA Change: V80E

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 176 9.2e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased drinking, increased urination, and dilation of the renal tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T A 11: 3,894,933 E52V probably benign Het
4930516K23Rik G A 7: 104,058,876 T242M probably damaging Het
Abcg5 T A 17: 84,682,825 I17F probably benign Het
Adam25 T A 8: 40,754,673 Y325* probably null Het
Adamts16 C T 13: 70,791,791 probably benign Het
Api5 A G 2: 94,425,029 L267P probably damaging Het
Asap3 T C 4: 136,236,415 Y329H probably benign Het
Atp13a4 C T 16: 29,454,774 R442K Het
Cadps2 T C 6: 23,302,301 D1129G probably benign Het
Cd79b T A 11: 106,312,806 Q145L probably benign Het
Cdh23 C T 10: 60,305,129 E3147K probably damaging Het
Col4a4 A G 1: 82,453,812 W1584R unknown Het
Cops8 T C 1: 90,604,433 L46P probably damaging Het
Cpne1 T C 2: 156,072,045 Y146C probably benign Het
Ctdnep1 T A 11: 69,984,485 V80E probably damaging Het
Cttnbp2 A G 6: 18,434,878 I327T probably benign Het
Cyp4a32 T C 4: 115,611,263 V314A probably damaging Het
Dlgap3 C A 4: 127,233,670 H710Q probably damaging Het
Dnah9 T C 11: 65,911,921 M3448V probably benign Het
E030018B13Rik C A 7: 63,919,979 Q84K unknown Het
Efna5 A G 17: 62,881,058 S25P possibly damaging Het
Egfl8 T G 17: 34,614,777 T76P probably damaging Het
Endod1 A G 9: 14,357,646 L181P probably damaging Het
Epha3 A G 16: 63,652,475 L349P possibly damaging Het
Fam161b T A 12: 84,348,282 T553S probably benign Het
Fmnl1 T C 11: 103,197,141 F981L unknown Het
Galr2 T A 11: 116,283,147 V201E probably damaging Het
Gm10436 T C 12: 88,177,182 E295G probably benign Het
Gm13023 C T 4: 143,792,752 Q28* probably null Het
Gpr137b T C 13: 13,359,406 Y355C Het
Greb1l T C 18: 10,541,825 S1191P probably benign Het
Hmg20b T C 10: 81,348,987 R84G probably damaging Het
Inppl1 T C 7: 101,823,386 D1234G possibly damaging Het
Insl5 A G 4: 103,026,563 S54P probably damaging Het
Itpr1 T A 6: 108,378,198 F483L possibly damaging Het
Kif21a T C 15: 90,971,727 E609G probably benign Het
Kpna7 A T 5: 145,005,030 V150D probably damaging Het
L1td1 T A 4: 98,733,938 C246S possibly damaging Het
Laptm4a T A 12: 8,938,139 M292K possibly damaging Het
Lefty2 C G 1: 180,897,478 P258A possibly damaging Het
Map4k1 G A 7: 29,001,627 V719M probably damaging Het
Nbas T A 12: 13,413,589 H1292Q probably benign Het
Nfkbia C T 12: 55,490,555 G250S probably damaging Het
Nkain3 T C 4: 20,245,902 T163A unknown Het
Npcd T C 15: 79,828,962 E88G probably benign Het
Oas1f A T 5: 120,851,493 Y165F probably benign Het
Olfr589 T C 7: 103,155,453 D98G probably benign Het
Olfr611 A G 7: 103,517,823 I187T possibly damaging Het
Olfr963 T A 9: 39,669,441 L128* probably null Het
Phtf2 T C 5: 20,803,277 I135M probably benign Het
Pi4ka T C 16: 17,307,740 E1177G Het
Polr3gl A T 3: 96,578,517 D214E probably damaging Het
Prkar1a C A 11: 109,665,918 Q275K probably benign Het
Ptprc A G 1: 138,126,301 probably null Het
Pwwp2a C A 11: 43,705,517 P503Q probably damaging Het
Rad17 T C 13: 100,617,684 probably benign Het
Rapgef6 T C 11: 54,679,239 L1146S probably benign Het
Rara C A 11: 98,973,626 Q460K unknown Het
Rassf4 C T 6: 116,661,936 probably benign Het
Rere A G 4: 150,612,014 D492G unknown Het
Selenon T G 4: 134,540,842 K460T possibly damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Slc35e1 T C 8: 72,488,144 T245A probably benign Het
Stat4 C T 1: 52,105,733 A726V probably benign Het
Stim1 G T 7: 102,421,390 V277L probably damaging Het
Strbp A G 2: 37,624,491 probably null Het
Tln2 T C 9: 67,266,823 Y860C probably damaging Het
Tmod4 T A 3: 95,125,978 probably null Het
Tpm3-rs7 T C 14: 113,315,061 V129A probably benign Het
Trp53bp2 C T 1: 182,446,406 P41S Het
Tubal3 G A 13: 3,933,428 D403N probably damaging Het
Wdr66 A G 5: 123,286,418 D722G possibly damaging Het
Zfp369 T C 13: 65,296,230 S396P possibly damaging Het
Zfp976 G A 7: 42,613,151 H422Y possibly damaging Het
Other mutations in Akr1b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Akr1b3 APN 6 34304319 missense probably damaging 1.00
R0567:Akr1b3 UTSW 6 34304345 splice site probably null
R0611:Akr1b3 UTSW 6 34309642 missense probably benign 0.02
R1564:Akr1b3 UTSW 6 34306535 splice site probably null
R2445:Akr1b3 UTSW 6 34310934 missense probably benign 0.26
R2507:Akr1b3 UTSW 6 34310064 missense probably damaging 1.00
R4323:Akr1b3 UTSW 6 34310927 missense probably benign 0.00
R4373:Akr1b3 UTSW 6 34304267 utr 3 prime probably benign
R4606:Akr1b3 UTSW 6 34306664 unclassified probably benign
R5513:Akr1b3 UTSW 6 34316646 intron probably benign
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6560:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6561:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6632:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6654:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6655:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6657:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6658:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6662:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R8209:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
R8226:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTTACATTGGCAGACAAGC -3'
(R):5'- ATGCATGTTGTGTCATGGCC -3'

Sequencing Primer
(F):5'- GCAGACAAGCCACAGGTC -3'
(R):5'- GCATGTTGTGTCATGGCCTAACC -3'
Posted On 2021-08-02