Incidental Mutation 'R8921:Itpr1'
ID 679246
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Name inositol 1,4,5-trisphosphate receptor 1
Synonyms P400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Is this an essential gene? Probably essential (E-score: 0.848) question?
Stock # R8921 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 108213096-108551109 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108378198 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 483 (F483L)
Ref Sequence ENSEMBL: ENSMUSP00000032192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000203936]
AlphaFold no structure available at present
PDB Structure Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032192
AA Change: F483L

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: F483L

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203615
AA Change: F483L

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: F483L

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203936
SMART Domains Protein: ENSMUSP00000145526
Gene: ENSMUSG00000030102

DomainStartEndE-ValueType
MIR 5 61 1.3e-11 SMART
MIR 68 162 1.6e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T A 11: 3,894,933 E52V probably benign Het
4930516K23Rik G A 7: 104,058,876 T242M probably damaging Het
Abcg5 T A 17: 84,682,825 I17F probably benign Het
Adam25 T A 8: 40,754,673 Y325* probably null Het
Adamts16 C T 13: 70,791,791 probably benign Het
Akr1b3 A T 6: 34,312,704 V57E probably benign Het
Api5 A G 2: 94,425,029 L267P probably damaging Het
Asap3 T C 4: 136,236,415 Y329H probably benign Het
Atp13a4 C T 16: 29,454,774 R442K Het
Cadps2 T C 6: 23,302,301 D1129G probably benign Het
Cd79b T A 11: 106,312,806 Q145L probably benign Het
Cdh23 C T 10: 60,305,129 E3147K probably damaging Het
Col4a4 A G 1: 82,453,812 W1584R unknown Het
Cops8 T C 1: 90,604,433 L46P probably damaging Het
Cpne1 T C 2: 156,072,045 Y146C probably benign Het
Ctdnep1 T A 11: 69,984,485 V80E probably damaging Het
Cttnbp2 A G 6: 18,434,878 I327T probably benign Het
Cyp4a32 T C 4: 115,611,263 V314A probably damaging Het
Dlgap3 C A 4: 127,233,670 H710Q probably damaging Het
Dnah9 T C 11: 65,911,921 M3448V probably benign Het
E030018B13Rik C A 7: 63,919,979 Q84K unknown Het
Efna5 A G 17: 62,881,058 S25P possibly damaging Het
Egfl8 T G 17: 34,614,777 T76P probably damaging Het
Endod1 A G 9: 14,357,646 L181P probably damaging Het
Epha3 A G 16: 63,652,475 L349P possibly damaging Het
Fam161b T A 12: 84,348,282 T553S probably benign Het
Fmnl1 T C 11: 103,197,141 F981L unknown Het
Galr2 T A 11: 116,283,147 V201E probably damaging Het
Gm10436 T C 12: 88,177,182 E295G probably benign Het
Gm13023 C T 4: 143,792,752 Q28* probably null Het
Gpr137b T C 13: 13,359,406 Y355C Het
Greb1l T C 18: 10,541,825 S1191P probably benign Het
Hmg20b T C 10: 81,348,987 R84G probably damaging Het
Inppl1 T C 7: 101,823,386 D1234G possibly damaging Het
Insl5 A G 4: 103,026,563 S54P probably damaging Het
Kif21a T C 15: 90,971,727 E609G probably benign Het
Kpna7 A T 5: 145,005,030 V150D probably damaging Het
L1td1 T A 4: 98,733,938 C246S possibly damaging Het
Laptm4a T A 12: 8,938,139 M292K possibly damaging Het
Lefty2 C G 1: 180,897,478 P258A possibly damaging Het
Map4k1 G A 7: 29,001,627 V719M probably damaging Het
Nbas T A 12: 13,413,589 H1292Q probably benign Het
Nfkbia C T 12: 55,490,555 G250S probably damaging Het
Nkain3 T C 4: 20,245,902 T163A unknown Het
Npcd T C 15: 79,828,962 E88G probably benign Het
Oas1f A T 5: 120,851,493 Y165F probably benign Het
Olfr589 T C 7: 103,155,453 D98G probably benign Het
Olfr611 A G 7: 103,517,823 I187T possibly damaging Het
Olfr963 T A 9: 39,669,441 L128* probably null Het
Phtf2 T C 5: 20,803,277 I135M probably benign Het
Pi4ka T C 16: 17,307,740 E1177G Het
Polr3gl A T 3: 96,578,517 D214E probably damaging Het
Prkar1a C A 11: 109,665,918 Q275K probably benign Het
Ptprc A G 1: 138,126,301 probably null Het
Pwwp2a C A 11: 43,705,517 P503Q probably damaging Het
Rad17 T C 13: 100,617,684 probably benign Het
Rapgef6 T C 11: 54,679,239 L1146S probably benign Het
Rara C A 11: 98,973,626 Q460K unknown Het
Rassf4 C T 6: 116,661,936 probably benign Het
Rere A G 4: 150,612,014 D492G unknown Het
Selenon T G 4: 134,540,842 K460T possibly damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Slc35e1 T C 8: 72,488,144 T245A probably benign Het
Stat4 C T 1: 52,105,733 A726V probably benign Het
Stim1 G T 7: 102,421,390 V277L probably damaging Het
Strbp A G 2: 37,624,491 probably null Het
Tln2 T C 9: 67,266,823 Y860C probably damaging Het
Tmod4 T A 3: 95,125,978 probably null Het
Tpm3-rs7 T C 14: 113,315,061 V129A probably benign Het
Trp53bp2 C T 1: 182,446,406 P41S Het
Tubal3 G A 13: 3,933,428 D403N probably damaging Het
Wdr66 A G 5: 123,286,418 D722G possibly damaging Het
Zfp369 T C 13: 65,296,230 S396P possibly damaging Het
Zfp976 G A 7: 42,613,151 H422Y possibly damaging Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108471120 missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108413820 missense probably benign 0.00
IGL01105:Itpr1 APN 6 108381333 missense probably benign 0.00
IGL01296:Itpr1 APN 6 108399361 missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108381208 missense probably benign 0.01
IGL01418:Itpr1 APN 6 108339624 critical splice donor site probably null
IGL01464:Itpr1 APN 6 108386727 missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108488496 missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108473599 missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108381032 nonsense probably null
IGL01969:Itpr1 APN 6 108377691 missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108389483 missense probably benign 0.08
IGL02206:Itpr1 APN 6 108549820 missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108417923 missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108339517 missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108489922 splice site probably null
IGL02568:Itpr1 APN 6 108339554 missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108381315 missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108417981 missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108523401 missense probably benign 0.00
IGL03333:Itpr1 APN 6 108380910 unclassified probably benign
aboriginal UTSW 6 108515947 missense probably benign
approximation UTSW 6 108394841 missense probably benign
estimate UTSW 6 108389553 missense probably null 1.00
icarus UTSW 6 108410900 missense probably damaging 1.00
marsupialized UTSW 6 108394073 splice site probably null
primordial UTSW 6 108518755 missense probably benign 0.06
roo UTSW 6 108410867 missense probably benign 0.00
wallaby UTSW 6 108389387 missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108381257 missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108493757 nonsense probably null
R0019:Itpr1 UTSW 6 108354626 missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108471209 splice site probably benign
R0129:Itpr1 UTSW 6 108349676 missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108488482 splice site probably benign
R0244:Itpr1 UTSW 6 108473589 missense probably benign 0.00
R0391:Itpr1 UTSW 6 108378167 missense probably benign 0.22
R0543:Itpr1 UTSW 6 108515748 splice site probably benign
R0647:Itpr1 UTSW 6 108383698 missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108410900 missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108349629 missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108510696 missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108339621 missense probably benign 0.22
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1605:Itpr1 UTSW 6 108349659 missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108482897 missense probably benign 0.38
R1852:Itpr1 UTSW 6 108386706 missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108440536 missense probably benign 0.02
R2027:Itpr1 UTSW 6 108386853 missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108378309 unclassified probably benign
R2166:Itpr1 UTSW 6 108388225 missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108369110 missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108406109 missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108349680 missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108381270 missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108394841 missense probably benign
R4081:Itpr1 UTSW 6 108391835 missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108394355 missense probably benign
R4406:Itpr1 UTSW 6 108354663 missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108432686 missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108481223 missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108481293 missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108410931 critical splice donor site probably null
R4760:Itpr1 UTSW 6 108349632 missense probably benign 0.29
R4836:Itpr1 UTSW 6 108389537 missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108410867 missense probably benign 0.00
R4876:Itpr1 UTSW 6 108482906 missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108440558 nonsense probably null
R5076:Itpr1 UTSW 6 108405529 splice site probably null
R5088:Itpr1 UTSW 6 108389387 missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108542062 missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108406145 missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108356511 missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108393961 missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108387498 missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108519424 missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108493794 missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108488600 missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108352143 missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108510738 missense probably benign 0.23
R5869:Itpr1 UTSW 6 108473529 missense probably benign 0.30
R5903:Itpr1 UTSW 6 108489797 intron probably benign
R5929:Itpr1 UTSW 6 108423336 missense probably benign
R5956:Itpr1 UTSW 6 108506027 missense probably benign 0.25
R6160:Itpr1 UTSW 6 108518755 missense probably benign 0.06
R6163:Itpr1 UTSW 6 108388284 missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108369116 missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108378203 missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108505903 missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108417972 missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108388276 missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108363683 missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108394073 splice site probably null
R6806:Itpr1 UTSW 6 108515947 missense probably benign
R6838:Itpr1 UTSW 6 108471191 missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108388192 missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108481394 missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108431498 critical splice donor site probably null
R7076:Itpr1 UTSW 6 108388296 missense probably benign
R7116:Itpr1 UTSW 6 108481268 missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108394407 critical splice donor site probably null
R7161:Itpr1 UTSW 6 108386640 missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108378190 missense probably benign 0.06
R7241:Itpr1 UTSW 6 108517620 critical splice donor site probably null
R7301:Itpr1 UTSW 6 108542024 missense possibly damaging 0.86
R7330:Itpr1 UTSW 6 108438331 missense probably benign 0.28
R7449:Itpr1 UTSW 6 108389384 missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108403396 missense probably benign 0.05
R7502:Itpr1 UTSW 6 108383678 missense probably benign 0.00
R7779:Itpr1 UTSW 6 108523348 missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108482931 missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108387369 missense probably damaging 1.00
R7974:Itpr1 UTSW 6 108523405 missense possibly damaging 0.86
R7998:Itpr1 UTSW 6 108417948 missense possibly damaging 0.88
R8039:Itpr1 UTSW 6 108386628 missense probably damaging 1.00
R8136:Itpr1 UTSW 6 108438360 missense probably benign 0.18
R8200:Itpr1 UTSW 6 108394865 missense probably benign 0.00
R8242:Itpr1 UTSW 6 108386697 missense probably benign 0.44
R8322:Itpr1 UTSW 6 108388229 missense probably benign 0.05
R8377:Itpr1 UTSW 6 108510738 missense probably benign 0.00
R8412:Itpr1 UTSW 6 108363620 missense probably benign 0.07
R8443:Itpr1 UTSW 6 108519348 missense probably damaging 0.99
R8669:Itpr1 UTSW 6 108393967 missense probably damaging 0.99
R8697:Itpr1 UTSW 6 108523366 missense probably damaging 1.00
R8744:Itpr1 UTSW 6 108377802 missense possibly damaging 0.79
R8870:Itpr1 UTSW 6 108388211 missense probably damaging 1.00
R8961:Itpr1 UTSW 6 108493705 missense possibly damaging 0.86
R9095:Itpr1 UTSW 6 108387391 missense probably benign 0.02
R9205:Itpr1 UTSW 6 108489849 missense probably damaging 0.99
R9282:Itpr1 UTSW 6 108394023 missense probably damaging 1.00
R9323:Itpr1 UTSW 6 108352018 missense probably damaging 1.00
R9376:Itpr1 UTSW 6 108349677 missense probably damaging 0.99
R9392:Itpr1 UTSW 6 108413876 missense probably benign
R9428:Itpr1 UTSW 6 108401347 missense possibly damaging 0.84
R9621:Itpr1 UTSW 6 108416909 missense probably damaging 1.00
R9632:Itpr1 UTSW 6 108405520 missense possibly damaging 0.50
R9646:Itpr1 UTSW 6 108394884 missense probably damaging 1.00
R9695:Itpr1 UTSW 6 108401350 missense probably damaging 1.00
R9710:Itpr1 UTSW 6 108405520 missense possibly damaging 0.50
R9721:Itpr1 UTSW 6 108406102 missense probably damaging 0.96
R9780:Itpr1 UTSW 6 108510834 missense probably benign 0.03
Z1176:Itpr1 UTSW 6 108499149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTGTATTATGCAGCTCCG -3'
(R):5'- TCCATCCTCCAAGTCTTAGGG -3'

Sequencing Primer
(F):5'- GCTCCGTTAGCCCCAGC -3'
(R):5'- CCTCCAAGTCTTAGGGATGAAAATC -3'
Posted On 2021-08-02