Incidental Mutation 'R8921:Stim1'
ID 679252
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Name stromal interaction molecule 1
Synonyms SIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8921 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102267806-102437319 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 102421390 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 277 (V277L)
Ref Sequence ENSEMBL: ENSMUSP00000033289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
AlphaFold P70302
Predicted Effect probably damaging
Transcript: ENSMUST00000033289
AA Change: V277L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: V277L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000211058
Predicted Effect possibly damaging
Transcript: ENSMUST00000211457
AA Change: V277L

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T A 11: 3,894,933 E52V probably benign Het
4930516K23Rik G A 7: 104,058,876 T242M probably damaging Het
Abcg5 T A 17: 84,682,825 I17F probably benign Het
Adam25 T A 8: 40,754,673 Y325* probably null Het
Adamts16 C T 13: 70,791,791 probably benign Het
Akr1b3 A T 6: 34,312,704 V57E probably benign Het
Api5 A G 2: 94,425,029 L267P probably damaging Het
Asap3 T C 4: 136,236,415 Y329H probably benign Het
Atp13a4 C T 16: 29,454,774 R442K Het
Cadps2 T C 6: 23,302,301 D1129G probably benign Het
Cd79b T A 11: 106,312,806 Q145L probably benign Het
Cdh23 C T 10: 60,305,129 E3147K probably damaging Het
Col4a4 A G 1: 82,453,812 W1584R unknown Het
Cops8 T C 1: 90,604,433 L46P probably damaging Het
Cpne1 T C 2: 156,072,045 Y146C probably benign Het
Ctdnep1 T A 11: 69,984,485 V80E probably damaging Het
Cttnbp2 A G 6: 18,434,878 I327T probably benign Het
Cyp4a32 T C 4: 115,611,263 V314A probably damaging Het
Dlgap3 C A 4: 127,233,670 H710Q probably damaging Het
Dnah9 T C 11: 65,911,921 M3448V probably benign Het
E030018B13Rik C A 7: 63,919,979 Q84K unknown Het
Efna5 A G 17: 62,881,058 S25P possibly damaging Het
Egfl8 T G 17: 34,614,777 T76P probably damaging Het
Endod1 A G 9: 14,357,646 L181P probably damaging Het
Epha3 A G 16: 63,652,475 L349P possibly damaging Het
Fam161b T A 12: 84,348,282 T553S probably benign Het
Fmnl1 T C 11: 103,197,141 F981L unknown Het
Galr2 T A 11: 116,283,147 V201E probably damaging Het
Gm10436 T C 12: 88,177,182 E295G probably benign Het
Gm13023 C T 4: 143,792,752 Q28* probably null Het
Gpr137b T C 13: 13,359,406 Y355C Het
Greb1l T C 18: 10,541,825 S1191P probably benign Het
Hmg20b T C 10: 81,348,987 R84G probably damaging Het
Inppl1 T C 7: 101,823,386 D1234G possibly damaging Het
Insl5 A G 4: 103,026,563 S54P probably damaging Het
Itpr1 T A 6: 108,378,198 F483L possibly damaging Het
Kif21a T C 15: 90,971,727 E609G probably benign Het
Kpna7 A T 5: 145,005,030 V150D probably damaging Het
L1td1 T A 4: 98,733,938 C246S possibly damaging Het
Laptm4a T A 12: 8,938,139 M292K possibly damaging Het
Lefty2 C G 1: 180,897,478 P258A possibly damaging Het
Map4k1 G A 7: 29,001,627 V719M probably damaging Het
Nbas T A 12: 13,413,589 H1292Q probably benign Het
Nfkbia C T 12: 55,490,555 G250S probably damaging Het
Nkain3 T C 4: 20,245,902 T163A unknown Het
Npcd T C 15: 79,828,962 E88G probably benign Het
Oas1f A T 5: 120,851,493 Y165F probably benign Het
Olfr589 T C 7: 103,155,453 D98G probably benign Het
Olfr611 A G 7: 103,517,823 I187T possibly damaging Het
Olfr963 T A 9: 39,669,441 L128* probably null Het
Phtf2 T C 5: 20,803,277 I135M probably benign Het
Pi4ka T C 16: 17,307,740 E1177G Het
Polr3gl A T 3: 96,578,517 D214E probably damaging Het
Prkar1a C A 11: 109,665,918 Q275K probably benign Het
Ptprc A G 1: 138,126,301 probably null Het
Pwwp2a C A 11: 43,705,517 P503Q probably damaging Het
Rad17 T C 13: 100,617,684 probably benign Het
Rapgef6 T C 11: 54,679,239 L1146S probably benign Het
Rara C A 11: 98,973,626 Q460K unknown Het
Rassf4 C T 6: 116,661,936 probably benign Het
Rere A G 4: 150,612,014 D492G unknown Het
Selenon T G 4: 134,540,842 K460T possibly damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Slc35e1 T C 8: 72,488,144 T245A probably benign Het
Stat4 C T 1: 52,105,733 A726V probably benign Het
Strbp A G 2: 37,624,491 probably null Het
Tln2 T C 9: 67,266,823 Y860C probably damaging Het
Tmod4 T A 3: 95,125,978 probably null Het
Tpm3-rs7 T C 14: 113,315,061 V129A probably benign Het
Trp53bp2 C T 1: 182,446,406 P41S Het
Tubal3 G A 13: 3,933,428 D403N probably damaging Het
Wdr66 A G 5: 123,286,418 D722G possibly damaging Het
Zfp369 T C 13: 65,296,230 S396P possibly damaging Het
Zfp976 G A 7: 42,613,151 H422Y possibly damaging Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102426747 missense probably damaging 1.00
IGL01390:Stim1 APN 7 102427162 missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102425969 splice site probably benign
IGL01826:Stim1 APN 7 102427075 splice site probably benign
IGL01908:Stim1 APN 7 102435650 missense probably benign
IGL02869:Stim1 APN 7 102268551 missense unknown
IGL03146:Stim1 APN 7 102421355 missense probably damaging 1.00
R0217:Stim1 UTSW 7 102435800 missense probably benign 0.00
R1320:Stim1 UTSW 7 102408406 missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102354541 missense probably benign 0.31
R1643:Stim1 UTSW 7 102386100 missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102354506 missense probably damaging 1.00
R2424:Stim1 UTSW 7 102408405 missense probably benign 0.03
R3838:Stim1 UTSW 7 102411296 missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102435641 missense probably benign 0.00
R4820:Stim1 UTSW 7 102415364 missense probably damaging 0.97
R4871:Stim1 UTSW 7 102354572 missense probably damaging 1.00
R5110:Stim1 UTSW 7 102268422 missense unknown
R5787:Stim1 UTSW 7 102435440 missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102430950 missense probably null 0.99
R6788:Stim1 UTSW 7 102427291 missense probably damaging 0.99
R7112:Stim1 UTSW 7 102408408 missense probably benign 0.01
R7125:Stim1 UTSW 7 102435534 missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102421532 critical splice donor site probably null
R7650:Stim1 UTSW 7 102428827 missense
R7807:Stim1 UTSW 7 102427141 missense probably damaging 0.99
R8304:Stim1 UTSW 7 102435481 missense possibly damaging 0.55
R8462:Stim1 UTSW 7 102427117 missense probably damaging 1.00
R8528:Stim1 UTSW 7 102431082 intron probably benign
R8883:Stim1 UTSW 7 102431050 missense unknown
R8924:Stim1 UTSW 7 102428807 missense
R9018:Stim1 UTSW 7 102411275 missense probably benign 0.05
R9164:Stim1 UTSW 7 102435419 missense probably benign 0.35
R9396:Stim1 UTSW 7 102415385 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CAGCAGAGTAGACAGGCTATATGC -3'
(R):5'- CACAAATGAAGCTTTCCGGCC -3'

Sequencing Primer
(F):5'- CAGGCTATATGCTGAGAGCTG -3'
(R):5'- TGAAGCTTTCCGGCCAGACC -3'
Posted On 2021-08-02