Incidental Mutation 'R8921:Stim1'
ID 679252
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Name stromal interaction molecule 1
Synonyms SIM
MMRRC Submission 068707-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8921 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 101917013-102086526 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 102070597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 277 (V277L)
Ref Sequence ENSEMBL: ENSMUSP00000033289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
AlphaFold P70302
Predicted Effect probably damaging
Transcript: ENSMUST00000033289
AA Change: V277L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: V277L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000211058
Predicted Effect possibly damaging
Transcript: ENSMUST00000211457
AA Change: V277L

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T A 11: 3,844,933 (GRCm39) E52V probably benign Het
4930516K23Rik G A 7: 103,708,083 (GRCm39) T242M probably damaging Het
Abcg5 T A 17: 84,990,253 (GRCm39) I17F probably benign Het
Adam25 T A 8: 41,207,710 (GRCm39) Y325* probably null Het
Adamts16 C T 13: 70,939,910 (GRCm39) probably benign Het
Akr1b1 A T 6: 34,289,639 (GRCm39) V57E probably benign Het
Api5 A G 2: 94,255,374 (GRCm39) L267P probably damaging Het
Asap3 T C 4: 135,963,726 (GRCm39) Y329H probably benign Het
Atp13a4 C T 16: 29,273,592 (GRCm39) R442K Het
Cadps2 T C 6: 23,302,300 (GRCm39) D1129G probably benign Het
Cd79b T A 11: 106,203,632 (GRCm39) Q145L probably benign Het
Cdh23 C T 10: 60,140,908 (GRCm39) E3147K probably damaging Het
Cfap251 A G 5: 123,424,481 (GRCm39) D722G possibly damaging Het
Col4a4 A G 1: 82,431,533 (GRCm39) W1584R unknown Het
Cops8 T C 1: 90,532,155 (GRCm39) L46P probably damaging Het
Cpne1 T C 2: 155,913,965 (GRCm39) Y146C probably benign Het
Ctdnep1 T A 11: 69,875,311 (GRCm39) V80E probably damaging Het
Cttnbp2 A G 6: 18,434,877 (GRCm39) I327T probably benign Het
Cyp4a32 T C 4: 115,468,460 (GRCm39) V314A probably damaging Het
Dlgap3 C A 4: 127,127,463 (GRCm39) H710Q probably damaging Het
Dnah9 T C 11: 65,802,747 (GRCm39) M3448V probably benign Het
E030018B13Rik C A 7: 63,569,727 (GRCm39) Q84K unknown Het
Efna5 A G 17: 63,188,053 (GRCm39) S25P possibly damaging Het
Egfl8 T G 17: 34,833,751 (GRCm39) T76P probably damaging Het
Endod1 A G 9: 14,268,942 (GRCm39) L181P probably damaging Het
Epha3 A G 16: 63,472,838 (GRCm39) L349P possibly damaging Het
Fam161b T A 12: 84,395,056 (GRCm39) T553S probably benign Het
Fmnl1 T C 11: 103,087,967 (GRCm39) F981L unknown Het
Galr2 T A 11: 116,173,973 (GRCm39) V201E probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Greb1l T C 18: 10,541,825 (GRCm39) S1191P probably benign Het
Hmg20b T C 10: 81,184,821 (GRCm39) R84G probably damaging Het
Inppl1 T C 7: 101,472,593 (GRCm39) D1234G possibly damaging Het
Insl5 A G 4: 102,883,760 (GRCm39) S54P probably damaging Het
Itpr1 T A 6: 108,355,159 (GRCm39) F483L possibly damaging Het
Kif21a T C 15: 90,855,930 (GRCm39) E609G probably benign Het
Kpna7 A T 5: 144,941,840 (GRCm39) V150D probably damaging Het
L1td1 T A 4: 98,622,175 (GRCm39) C246S possibly damaging Het
Laptm4a T A 12: 8,988,139 (GRCm39) M292K possibly damaging Het
Lefty2 C G 1: 180,725,043 (GRCm39) P258A possibly damaging Het
Map4k1 G A 7: 28,701,052 (GRCm39) V719M probably damaging Het
Nbas T A 12: 13,463,590 (GRCm39) H1292Q probably benign Het
Nfkbia C T 12: 55,537,340 (GRCm39) G250S probably damaging Het
Nkain3 T C 4: 20,245,902 (GRCm39) T163A unknown Het
Npcd T C 15: 79,713,163 (GRCm39) E88G probably benign Het
Oas1f A T 5: 120,989,556 (GRCm39) Y165F probably benign Het
Or10d4 T A 9: 39,580,737 (GRCm39) L128* probably null Het
Or51aa5 A G 7: 103,167,030 (GRCm39) I187T possibly damaging Het
Or52e2 T C 7: 102,804,660 (GRCm39) D98G probably benign Het
Phtf2 T C 5: 21,008,275 (GRCm39) I135M probably benign Het
Pi4ka T C 16: 17,125,604 (GRCm39) E1177G Het
Polr3gl A T 3: 96,485,833 (GRCm39) D214E probably damaging Het
Pramel25 C T 4: 143,519,322 (GRCm39) Q28* probably null Het
Pramel51 T C 12: 88,143,952 (GRCm39) E295G probably benign Het
Prkar1a C A 11: 109,556,744 (GRCm39) Q275K probably benign Het
Ptprc A G 1: 138,054,039 (GRCm39) probably null Het
Pwwp2a C A 11: 43,596,344 (GRCm39) P503Q probably damaging Het
Rad17 T C 13: 100,754,192 (GRCm39) probably benign Het
Rapgef6 T C 11: 54,570,065 (GRCm39) L1146S probably benign Het
Rara C A 11: 98,864,452 (GRCm39) Q460K unknown Het
Rassf4 C T 6: 116,638,897 (GRCm39) probably benign Het
Rere A G 4: 150,696,471 (GRCm39) D492G unknown Het
Selenon T G 4: 134,268,153 (GRCm39) K460T possibly damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Slc35e1 T C 8: 73,241,988 (GRCm39) T245A probably benign Het
Stat4 C T 1: 52,144,892 (GRCm39) A726V probably benign Het
Strbp A G 2: 37,514,503 (GRCm39) probably null Het
Tln2 T C 9: 67,174,105 (GRCm39) Y860C probably damaging Het
Tmod4 T A 3: 95,033,289 (GRCm39) probably null Het
Tpm3-rs7 T C 14: 113,552,493 (GRCm39) V129A probably benign Het
Trp53bp2 C T 1: 182,273,971 (GRCm39) P41S Het
Tubal3 G A 13: 3,983,428 (GRCm39) D403N probably damaging Het
Zfp369 T C 13: 65,444,044 (GRCm39) S396P possibly damaging Het
Zfp976 G A 7: 42,262,575 (GRCm39) H422Y possibly damaging Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102,075,954 (GRCm39) missense probably damaging 1.00
IGL01390:Stim1 APN 7 102,076,369 (GRCm39) missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102,035,322 (GRCm39) missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102,035,322 (GRCm39) missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102,075,176 (GRCm39) splice site probably benign
IGL01826:Stim1 APN 7 102,076,282 (GRCm39) splice site probably benign
IGL01908:Stim1 APN 7 102,084,857 (GRCm39) missense probably benign
IGL02869:Stim1 APN 7 101,917,758 (GRCm39) missense unknown
IGL03146:Stim1 APN 7 102,070,562 (GRCm39) missense probably damaging 1.00
R0217:Stim1 UTSW 7 102,085,007 (GRCm39) missense probably benign 0.00
R1320:Stim1 UTSW 7 102,057,613 (GRCm39) missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102,003,748 (GRCm39) missense probably benign 0.31
R1643:Stim1 UTSW 7 102,035,307 (GRCm39) missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102,003,713 (GRCm39) missense probably damaging 1.00
R2424:Stim1 UTSW 7 102,057,612 (GRCm39) missense probably benign 0.03
R3838:Stim1 UTSW 7 102,060,503 (GRCm39) missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102,084,848 (GRCm39) missense probably benign 0.00
R4820:Stim1 UTSW 7 102,064,571 (GRCm39) missense probably damaging 0.97
R4871:Stim1 UTSW 7 102,003,779 (GRCm39) missense probably damaging 1.00
R5110:Stim1 UTSW 7 101,917,629 (GRCm39) missense unknown
R5787:Stim1 UTSW 7 102,084,647 (GRCm39) missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102,080,157 (GRCm39) missense probably null 0.99
R6788:Stim1 UTSW 7 102,076,498 (GRCm39) missense probably damaging 0.99
R7112:Stim1 UTSW 7 102,057,615 (GRCm39) missense probably benign 0.01
R7125:Stim1 UTSW 7 102,084,741 (GRCm39) missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102,070,739 (GRCm39) critical splice donor site probably null
R7650:Stim1 UTSW 7 102,078,034 (GRCm39) missense
R7807:Stim1 UTSW 7 102,076,348 (GRCm39) missense probably damaging 0.99
R8304:Stim1 UTSW 7 102,084,688 (GRCm39) missense possibly damaging 0.55
R8462:Stim1 UTSW 7 102,076,324 (GRCm39) missense probably damaging 1.00
R8528:Stim1 UTSW 7 102,080,289 (GRCm39) intron probably benign
R8883:Stim1 UTSW 7 102,080,257 (GRCm39) missense unknown
R8924:Stim1 UTSW 7 102,078,014 (GRCm39) missense
R9018:Stim1 UTSW 7 102,060,482 (GRCm39) missense probably benign 0.05
R9164:Stim1 UTSW 7 102,084,626 (GRCm39) missense probably benign 0.35
R9396:Stim1 UTSW 7 102,064,592 (GRCm39) missense possibly damaging 0.63
R9487:Stim1 UTSW 7 102,080,257 (GRCm39) missense unknown
R9501:Stim1 UTSW 7 102,060,506 (GRCm39) missense possibly damaging 0.92
R9697:Stim1 UTSW 7 102,078,014 (GRCm39) missense
R9710:Stim1 UTSW 7 102,080,118 (GRCm39) small deletion probably benign
R9734:Stim1 UTSW 7 102,064,560 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CAGCAGAGTAGACAGGCTATATGC -3'
(R):5'- CACAAATGAAGCTTTCCGGCC -3'

Sequencing Primer
(F):5'- CAGGCTATATGCTGAGAGCTG -3'
(R):5'- TGAAGCTTTCCGGCCAGACC -3'
Posted On 2021-08-02