Mutagenetix > Incidental Mutations

Incidental Mutation 'R8921:Stim1'

679252

Institutional Source

Beutler Lab

Gene Symbol

Stim1

Ensembl Gene

ENSMUSG00000030987

Gene Name

stromal interaction molecule 1

Synonyms

SIM

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8921 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102267806-102437319 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 102421390 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 277 (V277L)

Ref Sequence

ENSEMBL: ENSMUSP00000033289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]

AlphaFold

P70302

Predicted Effect

probably damaging
Transcript: ENSMUST00000033289
AA Change: V277L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: V277L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
SAM	129	200	5.51e-6	SMART
SCOP:d1eq1a_	229	334	1e-2	SMART
PDB:4O9B\|D	237	340	3e-59	PDB
Pfam:SOAR	341	441	1.4e-46	PFAM
low complexity region	485	499	N/A	INTRINSIC
low complexity region	601	631	N/A	INTRINSIC
low complexity region	672	685	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211058

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211457
AA Change: V277L

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921536K21Rik	T	A	11: 3,894,933	E52V	probably benign	Het
4930516K23Rik	G	A	7: 104,058,876	T242M	probably damaging	Het
Abcg5	T	A	17: 84,682,825	I17F	probably benign	Het
Adam25	T	A	8: 40,754,673	Y325*	probably null	Het
Adamts16	C	T	13: 70,791,791		probably benign	Het
Akr1b3	A	T	6: 34,312,704	V57E	probably benign	Het
Api5	A	G	2: 94,425,029	L267P	probably damaging	Het
Asap3	T	C	4: 136,236,415	Y329H	probably benign	Het
Atp13a4	C	T	16: 29,454,774	R442K		Het
Cadps2	T	C	6: 23,302,301	D1129G	probably benign	Het
Cd79b	T	A	11: 106,312,806	Q145L	probably benign	Het
Cdh23	C	T	10: 60,305,129	E3147K	probably damaging	Het
Col4a4	A	G	1: 82,453,812	W1584R	unknown	Het
Cops8	T	C	1: 90,604,433	L46P	probably damaging	Het
Cpne1	T	C	2: 156,072,045	Y146C	probably benign	Het
Ctdnep1	T	A	11: 69,984,485	V80E	probably damaging	Het
Cttnbp2	A	G	6: 18,434,878	I327T	probably benign	Het
Cyp4a32	T	C	4: 115,611,263	V314A	probably damaging	Het
Dlgap3	C	A	4: 127,233,670	H710Q	probably damaging	Het
Dnah9	T	C	11: 65,911,921	M3448V	probably benign	Het
E030018B13Rik	C	A	7: 63,919,979	Q84K	unknown	Het
Efna5	A	G	17: 62,881,058	S25P	possibly damaging	Het
Egfl8	T	G	17: 34,614,777	T76P	probably damaging	Het
Endod1	A	G	9: 14,357,646	L181P	probably damaging	Het
Epha3	A	G	16: 63,652,475	L349P	possibly damaging	Het
Fam161b	T	A	12: 84,348,282	T553S	probably benign	Het
Fmnl1	T	C	11: 103,197,141	F981L	unknown	Het
Galr2	T	A	11: 116,283,147	V201E	probably damaging	Het
Gm10436	T	C	12: 88,177,182	E295G	probably benign	Het
Gm13023	C	T	4: 143,792,752	Q28*	probably null	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Greb1l	T	C	18: 10,541,825	S1191P	probably benign	Het
Hmg20b	T	C	10: 81,348,987	R84G	probably damaging	Het
Inppl1	T	C	7: 101,823,386	D1234G	possibly damaging	Het
Insl5	A	G	4: 103,026,563	S54P	probably damaging	Het
Itpr1	T	A	6: 108,378,198	F483L	possibly damaging	Het
Kif21a	T	C	15: 90,971,727	E609G	probably benign	Het
Kpna7	A	T	5: 145,005,030	V150D	probably damaging	Het
L1td1	T	A	4: 98,733,938	C246S	possibly damaging	Het
Laptm4a	T	A	12: 8,938,139	M292K	possibly damaging	Het
Lefty2	C	G	1: 180,897,478	P258A	possibly damaging	Het
Map4k1	G	A	7: 29,001,627	V719M	probably damaging	Het
Nbas	T	A	12: 13,413,589	H1292Q	probably benign	Het
Nfkbia	C	T	12: 55,490,555	G250S	probably damaging	Het
Nkain3	T	C	4: 20,245,902	T163A	unknown	Het
Npcd	T	C	15: 79,828,962	E88G	probably benign	Het
Oas1f	A	T	5: 120,851,493	Y165F	probably benign	Het
Olfr589	T	C	7: 103,155,453	D98G	probably benign	Het
Olfr611	A	G	7: 103,517,823	I187T	possibly damaging	Het
Olfr963	T	A	9: 39,669,441	L128*	probably null	Het
Phtf2	T	C	5: 20,803,277	I135M	probably benign	Het
Pi4ka	T	C	16: 17,307,740	E1177G		Het
Polr3gl	A	T	3: 96,578,517	D214E	probably damaging	Het
Prkar1a	C	A	11: 109,665,918	Q275K	probably benign	Het
Ptprc	A	G	1: 138,126,301		probably null	Het
Pwwp2a	C	A	11: 43,705,517	P503Q	probably damaging	Het
Rad17	T	C	13: 100,617,684		probably benign	Het
Rapgef6	T	C	11: 54,679,239	L1146S	probably benign	Het
Rara	C	A	11: 98,973,626	Q460K	unknown	Het
Rassf4	C	T	6: 116,661,936		probably benign	Het
Rere	A	G	4: 150,612,014	D492G	unknown	Het
Selenon	T	G	4: 134,540,842	K460T	possibly damaging	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Slc35e1	T	C	8: 72,488,144	T245A	probably benign	Het
Stat4	C	T	1: 52,105,733	A726V	probably benign	Het
Strbp	A	G	2: 37,624,491		probably null	Het
Tln2	T	C	9: 67,266,823	Y860C	probably damaging	Het
Tmod4	T	A	3: 95,125,978		probably null	Het
Tpm3-rs7	T	C	14: 113,315,061	V129A	probably benign	Het
Trp53bp2	C	T	1: 182,446,406	P41S		Het
Tubal3	G	A	13: 3,933,428	D403N	probably damaging	Het
Wdr66	A	G	5: 123,286,418	D722G	possibly damaging	Het
Zfp369	T	C	13: 65,296,230	S396P	possibly damaging	Het
Zfp976	G	A	7: 42,613,151	H422Y	possibly damaging	Het

Other mutations in Stim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Stim1	APN	7	102426747	missense	probably damaging	1.00
IGL01390:Stim1	APN	7	102427162	missense	possibly damaging	0.73
IGL01602:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01605:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01697:Stim1	APN	7	102425969	splice site	probably benign
IGL01826:Stim1	APN	7	102427075	splice site	probably benign
IGL01908:Stim1	APN	7	102435650	missense	probably benign
IGL02869:Stim1	APN	7	102268551	missense	unknown
IGL03146:Stim1	APN	7	102421355	missense	probably damaging	1.00
R0217:Stim1	UTSW	7	102435800	missense	probably benign	0.00
R1320:Stim1	UTSW	7	102408406	missense	possibly damaging	0.79
R1639:Stim1	UTSW	7	102354541	missense	probably benign	0.31
R1643:Stim1	UTSW	7	102386100	missense	possibly damaging	0.92
R1697:Stim1	UTSW	7	102354506	missense	probably damaging	1.00
R2424:Stim1	UTSW	7	102408405	missense	probably benign	0.03
R3838:Stim1	UTSW	7	102411296	missense	possibly damaging	0.71
R3940:Stim1	UTSW	7	102435641	missense	probably benign	0.00
R4820:Stim1	UTSW	7	102415364	missense	probably damaging	0.97
R4871:Stim1	UTSW	7	102354572	missense	probably damaging	1.00
R5110:Stim1	UTSW	7	102268422	missense	unknown
R5787:Stim1	UTSW	7	102435440	missense	possibly damaging	0.52
R6400:Stim1	UTSW	7	102430950	missense	probably null	0.99
R6788:Stim1	UTSW	7	102427291	missense	probably damaging	0.99
R7112:Stim1	UTSW	7	102408408	missense	probably benign	0.01
R7125:Stim1	UTSW	7	102435534	missense	possibly damaging	0.69
R7247:Stim1	UTSW	7	102421532	critical splice donor site	probably null
R7650:Stim1	UTSW	7	102428827	missense
R7807:Stim1	UTSW	7	102427141	missense	probably damaging	0.99
R8304:Stim1	UTSW	7	102435481	missense	possibly damaging	0.55
R8462:Stim1	UTSW	7	102427117	missense	probably damaging	1.00
R8528:Stim1	UTSW	7	102431082	intron	probably benign
R8883:Stim1	UTSW	7	102431050	missense	unknown
R8924:Stim1	UTSW	7	102428807	missense
R9018:Stim1	UTSW	7	102411275	missense	probably benign	0.05
R9164:Stim1	UTSW	7	102435419	missense	probably benign	0.35
R9396:Stim1	UTSW	7	102415385	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- CAGCAGAGTAGACAGGCTATATGC -3'
(R):5'- CACAAATGAAGCTTTCCGGCC -3'

Sequencing Primer
(F):5'- CAGGCTATATGCTGAGAGCTG -3'
(R):5'- TGAAGCTTTCCGGCCAGACC -3'

Posted On

2021-08-02