Incidental Mutation 'R8921:Dnah9'
ID679268
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Namedynein, axonemal, heavy chain 9
SynonymsD11Ertd686e, Dnahc9
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R8921 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location65831282-66168551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65911921 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 3448 (M3448V)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665] [ENSMUST00000130739]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080665
AA Change: M3448V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: M3448V

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130739
AA Change: M201V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116227
Gene: ENSMUSG00000056752
AA Change: M201V

DomainStartEndE-ValueType
Pfam:MT 1 172 7e-100 PFAM
Pfam:AAA_9 179 279 7.2e-59 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752
AA Change: M997V

DomainStartEndE-ValueType
Pfam:AAA_7 1 258 3e-155 PFAM
Pfam:AAA_8 336 603 3.9e-166 PFAM
Pfam:MT 615 958 2.3e-208 PFAM
Pfam:AAA_9 980 1202 1.1e-87 PFAM
Pfam:Dynein_heavy 1336 1514 2.4e-52 PFAM
Pfam:Dynein_heavy 1508 1956 8.6e-155 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T A 11: 3,894,933 E52V probably benign Het
4930516K23Rik G A 7: 104,058,876 T242M probably damaging Het
Abcg5 T A 17: 84,682,825 I17F probably benign Het
Adam25 T A 8: 40,754,673 Y325* probably null Het
Akr1b3 A T 6: 34,312,704 V57E probably benign Het
Api5 A G 2: 94,425,029 L267P probably damaging Het
Asap3 T C 4: 136,236,415 Y329H probably benign Het
Atp13a4 C T 16: 29,454,774 R442K Het
Cadps2 T C 6: 23,302,301 D1129G probably benign Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cd79b T A 11: 106,312,806 Q145L probably benign Het
Cdh23 C T 10: 60,305,129 E3147K probably damaging Het
Col4a4 A G 1: 82,453,812 W1584R unknown Het
Cops8 T C 1: 90,604,433 L46P probably damaging Het
Cpne1 T C 2: 156,072,045 Y146C probably benign Het
Ctdnep1 T A 11: 69,984,485 V80E probably damaging Het
Cttnbp2 A G 6: 18,434,878 I327T probably benign Het
Cyp4a32 T C 4: 115,611,263 V314A probably damaging Het
Dlgap3 C A 4: 127,233,670 H710Q probably damaging Het
E030018B13Rik C A 7: 63,919,979 Q84K unknown Het
Efna5 A G 17: 62,881,058 S25P possibly damaging Het
Egfl8 T G 17: 34,614,777 T76P probably damaging Het
Endod1 A G 9: 14,357,646 L181P probably damaging Het
Epha3 A G 16: 63,652,475 L349P possibly damaging Het
Fam161b T A 12: 84,348,282 T553S probably benign Het
Fmnl1 T C 11: 103,197,141 F981L unknown Het
Galr2 T A 11: 116,283,147 V201E probably damaging Het
Gm10436 T C 12: 88,177,182 E295G probably benign Het
Gm13023 C T 4: 143,792,752 Q28* probably null Het
Gpr137b T C 13: 13,359,406 Y355C Het
Greb1l T C 18: 10,541,825 S1191P probably benign Het
Hmg20b T C 10: 81,348,987 R84G probably damaging Het
Inppl1 T C 7: 101,823,386 D1234G possibly damaging Het
Insl5 A G 4: 103,026,563 S54P probably damaging Het
Itpr1 T A 6: 108,378,198 F483L possibly damaging Het
Kif21a T C 15: 90,971,727 E609G probably benign Het
Kpna7 A T 5: 145,005,030 V150D probably damaging Het
L1td1 T A 4: 98,733,938 C246S possibly damaging Het
Laptm4a T A 12: 8,938,139 M292K possibly damaging Het
Lefty2 C G 1: 180,897,478 P258A possibly damaging Het
Map4k1 G A 7: 29,001,627 V719M probably damaging Het
Nbas T A 12: 13,413,589 H1292Q probably benign Het
Nfkbia C T 12: 55,490,555 G250S probably damaging Het
Nkain3 T C 4: 20,245,902 T163A unknown Het
Npcd T C 15: 79,828,962 E88G probably benign Het
Oas1f A T 5: 120,851,493 Y165F probably benign Het
Olfr589 T C 7: 103,155,453 D98G probably benign Het
Olfr611 A G 7: 103,517,823 I187T possibly damaging Het
Olfr963 T A 9: 39,669,441 L128* probably null Het
Phtf2 T C 5: 20,803,277 I135M probably benign Het
Pi4ka T C 16: 17,307,740 E1177G Het
Polr3gl A T 3: 96,578,517 D214E probably damaging Het
Prkar1a C A 11: 109,665,918 Q275K probably benign Het
Ptprc A G 1: 138,126,301 probably null Het
Pwwp2a C A 11: 43,705,517 P503Q probably damaging Het
Rad17 T C 13: 100,617,684 probably benign Het
Rapgef6 T C 11: 54,679,239 L1146S probably benign Het
Rara C A 11: 98,973,626 Q460K unknown Het
Rassf4 C T 6: 116,661,936 probably benign Het
Rere A G 4: 150,612,014 D492G unknown Het
Selenon T G 4: 134,540,842 K460T possibly damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 TCAGCCACGGGGACCAGC TCAGCCACGGGGACCAGCCCAGCCACGGGGACCAGC 7: 126,467,581 probably benign Het
Slc35e1 T C 8: 72,488,144 T245A probably benign Het
Stat4 C T 1: 52,105,733 A726V probably benign Het
Stim1 G T 7: 102,421,390 V277L probably damaging Het
Strbp A G 2: 37,624,491 probably null Het
Tln2 T C 9: 67,266,823 Y860C probably damaging Het
Tmod4 T A 3: 95,125,978 probably null Het
Tpm3-rs7 T C 14: 113,315,061 V129A probably benign Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Trp53bp2 C T 1: 182,446,406 P41S Het
Tubal3 G A 13: 3,933,428 D403N probably damaging Het
Wdr66 A G 5: 123,286,418 D722G possibly damaging Het
Zfp369 T C 13: 65,296,230 S396P possibly damaging Het
Zfp976 G A 7: 42,613,151 H422Y possibly damaging Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65841238 splice site probably benign
IGL00805:Dnah9 APN 11 65881695 missense probably benign 0.00
IGL00826:Dnah9 APN 11 65989942 missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65849980 missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 66072056 missense probably damaging 1.00
IGL01353:Dnah9 APN 11 66080571 missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66155459 missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65955717 missense probably benign 0.14
IGL01537:Dnah9 APN 11 65947680 missense probably benign
IGL01565:Dnah9 APN 11 66033829 missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66118830 missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65831615 nonsense probably null
IGL01625:Dnah9 APN 11 66044645 missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66118829 missense probably damaging 1.00
IGL01819:Dnah9 APN 11 66108126 missense probably benign 0.33
IGL01896:Dnah9 APN 11 66130666 missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 66075034 splice site probably benign
IGL01923:Dnah9 APN 11 66125235 splice site probably benign
IGL02059:Dnah9 APN 11 66072958 missense probably damaging 1.00
IGL02068:Dnah9 APN 11 66061045 missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66117492 missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65927700 missense probably damaging 1.00
IGL02264:Dnah9 APN 11 66080488 splice site probably benign
IGL02325:Dnah9 APN 11 65834217 missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66125153 missense probably benign
IGL02440:Dnah9 APN 11 65955246 missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65947618 nonsense probably null
IGL02496:Dnah9 APN 11 66029363 missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65927601 missense probably benign 0.02
IGL02718:Dnah9 APN 11 65886640 missense probably damaging 0.99
IGL02832:Dnah9 APN 11 66040346 missense probably damaging 1.00
IGL02851:Dnah9 APN 11 66037744 splice site probably benign
IGL02859:Dnah9 APN 11 65881619 splice site probably benign
IGL02864:Dnah9 APN 11 66061003 missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66118967 missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65855272 missense probably damaging 0.98
IGL02987:Dnah9 APN 11 65841273 missense probably benign 0.23
IGL03160:Dnah9 APN 11 66108054 missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65981241 missense probably benign 0.13
IGL03180:Dnah9 APN 11 65886639 missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65947542 missense probably damaging 1.00
anarchy UTSW 11 65955248 missense probably damaging 0.99
sacco UTSW 11 66168079 missense possibly damaging 0.82
Tweed UTSW 11 66072072 missense probably damaging 0.99
vanzetti UTSW 11 65855372 nonsense probably null
IGL02837:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 66005013 missense probably benign 0.44
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0070:Dnah9 UTSW 11 66160040 missense probably benign 0.10
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0180:Dnah9 UTSW 11 66147290 missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65895905 missense probably benign 0.30
R0230:Dnah9 UTSW 11 65855315 missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65911852 missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65911789 critical splice donor site probably null
R0288:Dnah9 UTSW 11 66025134 critical splice donor site probably null
R0309:Dnah9 UTSW 11 66026972 splice site probably benign
R0356:Dnah9 UTSW 11 66130562 critical splice donor site probably null
R0403:Dnah9 UTSW 11 66084789 missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 66108135 missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65918713 splice site probably benign
R0496:Dnah9 UTSW 11 66075135 missense probably null 1.00
R0557:Dnah9 UTSW 11 66084666 missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65990489 missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66118877 missense probably benign 0.02
R0599:Dnah9 UTSW 11 65965689 missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65841333 missense probably damaging 1.00
R0666:Dnah9 UTSW 11 66085458 missense probably benign 0.01
R0715:Dnah9 UTSW 11 66081248 splice site probably benign
R0726:Dnah9 UTSW 11 65965681 missense probably damaging 1.00
R0737:Dnah9 UTSW 11 66107898 missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66155530 missense probably benign 0.30
R0792:Dnah9 UTSW 11 65896001 missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 66005176 missense probably benign 0.00
R0973:Dnah9 UTSW 11 66005837 splice site probably null
R0974:Dnah9 UTSW 11 66005837 splice site probably null
R1055:Dnah9 UTSW 11 66160011 missense probably damaging 1.00
R1081:Dnah9 UTSW 11 66084877 missense probably damaging 0.99
R1184:Dnah9 UTSW 11 66084612 critical splice donor site probably null
R1225:Dnah9 UTSW 11 65871060 missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65927588 missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65955747 missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65874132 missense probably benign 0.22
R1447:Dnah9 UTSW 11 66108482 missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65927786 missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1486:Dnah9 UTSW 11 65834272 missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65881761 missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66112330 missense probably benign
R1617:Dnah9 UTSW 11 65895921 missense probably damaging 1.00
R1623:Dnah9 UTSW 11 66037637 missense probably damaging 1.00
R1626:Dnah9 UTSW 11 66085267 missense probably benign 0.05
R1671:Dnah9 UTSW 11 65927963 missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65954824 nonsense probably null
R1701:Dnah9 UTSW 11 65911924 missense probably damaging 1.00
R1702:Dnah9 UTSW 11 66085195 missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65915154 missense probably benign 0.11
R1718:Dnah9 UTSW 11 66168079 missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65981222 missense probably benign 0.31
R1784:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66119594 critical splice donor site probably null
R1801:Dnah9 UTSW 11 65955297 missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65850061 missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66118841 missense probably benign 0.10
R1840:Dnah9 UTSW 11 65834198 nonsense probably null
R1847:Dnah9 UTSW 11 65834386 missense probably damaging 1.00
R1872:Dnah9 UTSW 11 66037490 missense probably benign 0.16
R1929:Dnah9 UTSW 11 65976398 missense probably benign 0.05
R1969:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65955338 missense probably benign 0.11
R2049:Dnah9 UTSW 11 66044683 missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66145435 missense probably benign 0.31
R2104:Dnah9 UTSW 11 66061124 missense probably damaging 1.00
R2109:Dnah9 UTSW 11 66037585 missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66117483 missense probably damaging 1.00
R2172:Dnah9 UTSW 11 66072779 missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65859499 missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2272:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2396:Dnah9 UTSW 11 66085158 missense probably benign 0.01
R2398:Dnah9 UTSW 11 65915203 missense probably damaging 1.00
R2418:Dnah9 UTSW 11 66095415 nonsense probably null
R2419:Dnah9 UTSW 11 66095415 nonsense probably null
R2510:Dnah9 UTSW 11 66005169 missense probably damaging 1.00
R2680:Dnah9 UTSW 11 66033925 missense probably benign 0.00
R2875:Dnah9 UTSW 11 66168461 missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66117588 missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3237:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3433:Dnah9 UTSW 11 66075112 missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66156908 nonsense probably null
R3820:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3821:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3822:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3861:Dnah9 UTSW 11 66052994 splice site probably benign
R3918:Dnah9 UTSW 11 65870974 missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65834464 missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66133635 missense probably benign 0.03
R4072:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4076:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4097:Dnah9 UTSW 11 65990459 missense probably damaging 1.00
R4409:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65981214 missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66118749 missense probably benign 0.00
R4434:Dnah9 UTSW 11 66108075 missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65881641 missense probably benign 0.07
R4452:Dnah9 UTSW 11 66027082 missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66147389 missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4590:Dnah9 UTSW 11 66040392 missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66168152 missense probably benign
R4655:Dnah9 UTSW 11 65955732 missense probably benign 0.00
R4667:Dnah9 UTSW 11 66155531 missense probably benign
R4718:Dnah9 UTSW 11 66085473 missense probably benign
R4720:Dnah9 UTSW 11 66076358 missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65927726 missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65874124 nonsense probably null
R4963:Dnah9 UTSW 11 66084611 splice site probably null
R5074:Dnah9 UTSW 11 65850040 missense probably damaging 1.00
R5230:Dnah9 UTSW 11 66084666 missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66112333 missense probably benign 0.34
R5364:Dnah9 UTSW 11 65881696 missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 66029354 missense probably damaging 1.00
R5386:Dnah9 UTSW 11 66029356 missense probably damaging 1.00
R5389:Dnah9 UTSW 11 66095314 nonsense probably null
R5541:Dnah9 UTSW 11 66145336 missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65881740 missense probably benign 0.00
R5576:Dnah9 UTSW 11 65834096 splice site probably null
R5648:Dnah9 UTSW 11 65927755 missense probably benign 0.00
R5653:Dnah9 UTSW 11 65849980 missense probably damaging 0.99
R5713:Dnah9 UTSW 11 66025223 missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65955239 missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66126601 missense probably benign 0.01
R5831:Dnah9 UTSW 11 66108121 missense probably benign 0.00
R5847:Dnah9 UTSW 11 66095240 frame shift probably null
R5870:Dnah9 UTSW 11 66085210 missense probably benign 0.01
R5902:Dnah9 UTSW 11 66025187 missense probably benign 0.08
R5918:Dnah9 UTSW 11 65834199 missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65834481 missense probably damaging 1.00
R6065:Dnah9 UTSW 11 65855338 missense probably benign 0.05
R6065:Dnah9 UTSW 11 66145397 missense possibly damaging 0.65
R6086:Dnah9 UTSW 11 65989915 missense probably damaging 0.99
R6086:Dnah9 UTSW 11 66085174 missense probably benign
R6102:Dnah9 UTSW 11 65990516 missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66147399 missense probably benign
R6154:Dnah9 UTSW 11 65855338 missense probably benign 0.00
R6262:Dnah9 UTSW 11 65881805 splice site probably null
R6265:Dnah9 UTSW 11 66168094 missense probably benign 0.04
R6290:Dnah9 UTSW 11 65841375 missense probably damaging 1.00
R6345:Dnah9 UTSW 11 66037693 missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65955248 missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66168281 missense probably benign 0.37
R6582:Dnah9 UTSW 11 66061097 missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65955366 missense probably damaging 1.00
R6800:Dnah9 UTSW 11 66072739 critical splice donor site probably null
R6812:Dnah9 UTSW 11 65981329 missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66117626 missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 66085149 missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 66076341 missense probably damaging 1.00
R6977:Dnah9 UTSW 11 66107909 missense probably benign 0.37
R7021:Dnah9 UTSW 11 65981231 missense probably benign
R7161:Dnah9 UTSW 11 65855372 nonsense probably null
R7175:Dnah9 UTSW 11 66133637 missense probably benign 0.03
R7199:Dnah9 UTSW 11 66118944 missense probably benign 0.04
R7231:Dnah9 UTSW 11 65965647 missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65990476 missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65989851 missense probably benign 0.00
R7350:Dnah9 UTSW 11 66080578 missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66117407 critical splice donor site probably null
R7427:Dnah9 UTSW 11 65955219 missense probably benign
R7477:Dnah9 UTSW 11 65992731 missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65841414 missense probably benign 0.01
R7521:Dnah9 UTSW 11 65989837 missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66125215 missense probably benign 0.43
R7659:Dnah9 UTSW 11 65989780 missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66118958 missense probably damaging 1.00
R7749:Dnah9 UTSW 11 65911830 missense probably damaging 1.00
R7792:Dnah9 UTSW 11 65850013 missense probably damaging 1.00
R7808:Dnah9 UTSW 11 66005805 nonsense probably null
R7814:Dnah9 UTSW 11 66005660 missense probably damaging 1.00
R7818:Dnah9 UTSW 11 66025211 missense possibly damaging 0.64
R7890:Dnah9 UTSW 11 66072072 missense probably damaging 0.99
R7976:Dnah9 UTSW 11 65841401 missense possibly damaging 0.91
R8121:Dnah9 UTSW 11 66017375 missense probably benign 0.02
R8232:Dnah9 UTSW 11 65855323 missense possibly damaging 0.91
R8311:Dnah9 UTSW 11 65989818 missense probably benign 0.00
R8326:Dnah9 UTSW 11 66117626 missense probably benign 0.01
R8338:Dnah9 UTSW 11 65841241 critical splice donor site probably null
R8356:Dnah9 UTSW 11 66156938 missense probably damaging 0.99
R8456:Dnah9 UTSW 11 66156938 missense probably damaging 0.99
R8468:Dnah9 UTSW 11 65831730 missense probably benign 0.00
R8721:Dnah9 UTSW 11 66095298 missense probably damaging 1.00
R8747:Dnah9 UTSW 11 65927990 missense possibly damaging 0.69
R8798:Dnah9 UTSW 11 65905231 missense probably damaging 0.99
R8806:Dnah9 UTSW 11 65859483 missense probably damaging 1.00
R8826:Dnah9 UTSW 11 65849916 missense probably benign 0.13
R8837:Dnah9 UTSW 11 65855234 missense possibly damaging 0.72
R8886:Dnah9 UTSW 11 66053014 missense probably damaging 1.00
R8887:Dnah9 UTSW 11 65855384 missense probably benign 0.01
R8933:Dnah9 UTSW 11 65855252 missense possibly damaging 0.88
R8949:Dnah9 UTSW 11 66168400 missense possibly damaging 0.91
R8967:Dnah9 UTSW 11 66125112 critical splice donor site probably null
R8979:Dnah9 UTSW 11 66005152 missense probably benign
R8991:Dnah9 UTSW 11 65886680 missense probably damaging 0.96
R9016:Dnah9 UTSW 11 66108030 missense probably damaging 0.99
R9025:Dnah9 UTSW 11 66005825 missense probably damaging 1.00
R9043:Dnah9 UTSW 11 65954854 missense
R9047:Dnah9 UTSW 11 66072099 missense possibly damaging 0.89
R9076:Dnah9 UTSW 11 66117638 missense probably benign 0.21
R9113:Dnah9 UTSW 11 65989887 missense probably damaging 1.00
R9152:Dnah9 UTSW 11 66130631 missense probably damaging 1.00
V3553:Dnah9 UTSW 11 65970076 missense probably damaging 1.00
X0027:Dnah9 UTSW 11 66085479 missense probably benign 0.07
X0028:Dnah9 UTSW 11 65990452 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65895972 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65927853 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65970084 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 66037474 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 66072835 missense probably damaging 1.00
Z1177:Dnah9 UTSW 11 66126650 missense probably damaging 1.00
Z1186:Dnah9 UTSW 11 66085174 missense probably benign
Z1186:Dnah9 UTSW 11 66147381 missense probably benign
Z1187:Dnah9 UTSW 11 66085174 missense probably benign
Z1187:Dnah9 UTSW 11 66147381 missense probably benign
Z1188:Dnah9 UTSW 11 66085174 missense probably benign
Z1188:Dnah9 UTSW 11 66147381 missense probably benign
Z1189:Dnah9 UTSW 11 66085174 missense probably benign
Z1189:Dnah9 UTSW 11 66147381 missense probably benign
Z1190:Dnah9 UTSW 11 66085174 missense probably benign
Z1190:Dnah9 UTSW 11 66147381 missense probably benign
Z1191:Dnah9 UTSW 11 66085174 missense probably benign
Z1191:Dnah9 UTSW 11 66147381 missense probably benign
Z1192:Dnah9 UTSW 11 66085174 missense probably benign
Z1192:Dnah9 UTSW 11 66147381 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTTACCTGATGGAGAGTTCAG -3'
(R):5'- AGACACTGTGGATTCTCCCC -3'

Sequencing Primer
(F):5'- AAGACACCAGGGTTTATGTTTGCTC -3'
(R):5'- CCCACAGAGATAGTTTTCCATTCAG -3'
Posted On2021-08-02