Incidental Mutation 'R8921:Greb1l'
ID 679295
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms mKIAA4095, AK220484
MMRRC Submission 068707-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8921 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 10325177-10562940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10541825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1191 (S1191P)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: S1191P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: S1191P

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T A 11: 3,844,933 (GRCm39) E52V probably benign Het
4930516K23Rik G A 7: 103,708,083 (GRCm39) T242M probably damaging Het
Abcg5 T A 17: 84,990,253 (GRCm39) I17F probably benign Het
Adam25 T A 8: 41,207,710 (GRCm39) Y325* probably null Het
Adamts16 C T 13: 70,939,910 (GRCm39) probably benign Het
Akr1b1 A T 6: 34,289,639 (GRCm39) V57E probably benign Het
Api5 A G 2: 94,255,374 (GRCm39) L267P probably damaging Het
Asap3 T C 4: 135,963,726 (GRCm39) Y329H probably benign Het
Atp13a4 C T 16: 29,273,592 (GRCm39) R442K Het
Cadps2 T C 6: 23,302,300 (GRCm39) D1129G probably benign Het
Cd79b T A 11: 106,203,632 (GRCm39) Q145L probably benign Het
Cdh23 C T 10: 60,140,908 (GRCm39) E3147K probably damaging Het
Cfap251 A G 5: 123,424,481 (GRCm39) D722G possibly damaging Het
Col4a4 A G 1: 82,431,533 (GRCm39) W1584R unknown Het
Cops8 T C 1: 90,532,155 (GRCm39) L46P probably damaging Het
Cpne1 T C 2: 155,913,965 (GRCm39) Y146C probably benign Het
Ctdnep1 T A 11: 69,875,311 (GRCm39) V80E probably damaging Het
Cttnbp2 A G 6: 18,434,877 (GRCm39) I327T probably benign Het
Cyp4a32 T C 4: 115,468,460 (GRCm39) V314A probably damaging Het
Dlgap3 C A 4: 127,127,463 (GRCm39) H710Q probably damaging Het
Dnah9 T C 11: 65,802,747 (GRCm39) M3448V probably benign Het
E030018B13Rik C A 7: 63,569,727 (GRCm39) Q84K unknown Het
Efna5 A G 17: 63,188,053 (GRCm39) S25P possibly damaging Het
Egfl8 T G 17: 34,833,751 (GRCm39) T76P probably damaging Het
Endod1 A G 9: 14,268,942 (GRCm39) L181P probably damaging Het
Epha3 A G 16: 63,472,838 (GRCm39) L349P possibly damaging Het
Fam161b T A 12: 84,395,056 (GRCm39) T553S probably benign Het
Fmnl1 T C 11: 103,087,967 (GRCm39) F981L unknown Het
Galr2 T A 11: 116,173,973 (GRCm39) V201E probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Hmg20b T C 10: 81,184,821 (GRCm39) R84G probably damaging Het
Inppl1 T C 7: 101,472,593 (GRCm39) D1234G possibly damaging Het
Insl5 A G 4: 102,883,760 (GRCm39) S54P probably damaging Het
Itpr1 T A 6: 108,355,159 (GRCm39) F483L possibly damaging Het
Kif21a T C 15: 90,855,930 (GRCm39) E609G probably benign Het
Kpna7 A T 5: 144,941,840 (GRCm39) V150D probably damaging Het
L1td1 T A 4: 98,622,175 (GRCm39) C246S possibly damaging Het
Laptm4a T A 12: 8,988,139 (GRCm39) M292K possibly damaging Het
Lefty2 C G 1: 180,725,043 (GRCm39) P258A possibly damaging Het
Map4k1 G A 7: 28,701,052 (GRCm39) V719M probably damaging Het
Nbas T A 12: 13,463,590 (GRCm39) H1292Q probably benign Het
Nfkbia C T 12: 55,537,340 (GRCm39) G250S probably damaging Het
Nkain3 T C 4: 20,245,902 (GRCm39) T163A unknown Het
Npcd T C 15: 79,713,163 (GRCm39) E88G probably benign Het
Oas1f A T 5: 120,989,556 (GRCm39) Y165F probably benign Het
Or10d4 T A 9: 39,580,737 (GRCm39) L128* probably null Het
Or51aa5 A G 7: 103,167,030 (GRCm39) I187T possibly damaging Het
Or52e2 T C 7: 102,804,660 (GRCm39) D98G probably benign Het
Phtf2 T C 5: 21,008,275 (GRCm39) I135M probably benign Het
Pi4ka T C 16: 17,125,604 (GRCm39) E1177G Het
Polr3gl A T 3: 96,485,833 (GRCm39) D214E probably damaging Het
Pramel25 C T 4: 143,519,322 (GRCm39) Q28* probably null Het
Pramel51 T C 12: 88,143,952 (GRCm39) E295G probably benign Het
Prkar1a C A 11: 109,556,744 (GRCm39) Q275K probably benign Het
Ptprc A G 1: 138,054,039 (GRCm39) probably null Het
Pwwp2a C A 11: 43,596,344 (GRCm39) P503Q probably damaging Het
Rad17 T C 13: 100,754,192 (GRCm39) probably benign Het
Rapgef6 T C 11: 54,570,065 (GRCm39) L1146S probably benign Het
Rara C A 11: 98,864,452 (GRCm39) Q460K unknown Het
Rassf4 C T 6: 116,638,897 (GRCm39) probably benign Het
Rere A G 4: 150,696,471 (GRCm39) D492G unknown Het
Selenon T G 4: 134,268,153 (GRCm39) K460T possibly damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Slc35e1 T C 8: 73,241,988 (GRCm39) T245A probably benign Het
Stat4 C T 1: 52,144,892 (GRCm39) A726V probably benign Het
Stim1 G T 7: 102,070,597 (GRCm39) V277L probably damaging Het
Strbp A G 2: 37,514,503 (GRCm39) probably null Het
Tln2 T C 9: 67,174,105 (GRCm39) Y860C probably damaging Het
Tmod4 T A 3: 95,033,289 (GRCm39) probably null Het
Tpm3-rs7 T C 14: 113,552,493 (GRCm39) V129A probably benign Het
Trp53bp2 C T 1: 182,273,971 (GRCm39) P41S Het
Tubal3 G A 13: 3,983,428 (GRCm39) D403N probably damaging Het
Zfp369 T C 13: 65,444,044 (GRCm39) S396P possibly damaging Het
Zfp976 G A 7: 42,262,575 (GRCm39) H422Y possibly damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm39) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm39) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm39) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm39) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm39) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm39) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm39) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm39) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm39) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm39) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm39) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm39) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm39) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm39) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm39) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm39) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm39) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm39) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm39) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm39) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm39) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm39) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm39) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm39) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm39) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm39) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm39) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm39) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm39) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm39) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm39) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm39) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm39) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm39) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm39) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm39) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm39) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm39) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm39) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm39) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm39) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm39) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm39) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm39) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm39) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm39) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm39) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm39) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm39) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm39) missense probably benign 0.00
R4819:Greb1l UTSW 18 10,458,358 (GRCm39) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm39) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm39) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm39) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm39) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm39) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm39) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm39) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm39) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm39) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm39) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm39) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm39) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm39) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm39) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm39) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm39) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm39) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm39) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm39) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm39) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm39) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm39) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm39) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm39) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm39) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm39) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm39) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm39) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm39) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm39) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm39) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm39) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm39) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm39) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm39) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm39) missense probably benign 0.01
R8795:Greb1l UTSW 18 10,553,739 (GRCm39) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm39) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm39) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm39) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm39) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm39) missense probably benign 0.21
R8997:Greb1l UTSW 18 10,510,747 (GRCm39) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm39) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm39) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm39) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm39) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm39) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm39) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm39) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm39) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm39) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm39) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCATGGAGAATGGGGTGAGTTC -3'
(R):5'- CTCATGTCTTTGTGCAGGCC -3'

Sequencing Primer
(F):5'- CTTCTAGCACGGCTGGCAAAC -3'
(R):5'- AGGCCACATCAGCATGGG -3'
Posted On 2021-08-02