Mutagenetix > Incidental Mutations

Incidental Mutation 'R8922:Sec24d'

679310

Institutional Source

Beutler Lab

Gene Symbol

Sec24d

Ensembl Gene

ENSMUSG00000039234

Gene Name

Sec24 related gene family, member D (S. cerevisiae)

Synonyms

2310020L09Rik, LOC383951

Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8922 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123267455-123365641 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 123350839 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 655 (G655E)

Ref Sequence

ENSEMBL: ENSMUSP00000035823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047923]

AlphaFold

Q6NXL1

Predicted Effect

probably damaging
Transcript: ENSMUST00000047923
AA Change: G655E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: G655E

Domain	Start	End	E-Value	Type
low complexity region	46	71	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	136	160	N/A	INTRINSIC
low complexity region	197	222	N/A	INTRINSIC
low complexity region	238	256	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	360	398	1.8e-16	PFAM
Pfam:Sec23_trunk	437	681	3.6e-88	PFAM
Pfam:Sec23_BS	686	770	2e-20	PFAM
Pfam:Sec23_helical	783	884	1e-27	PFAM
Pfam:Gelsolin	899	974	4.2e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933402J07Rik	A	G	8: 87,568,549	D105G	possibly damaging	Het
Abhd14b	T	C	9: 106,451,636		probably null	Het
Acot1	C	T	12: 84,017,311	Q398*	probably null	Het
Adam26b	A	T	8: 43,520,179	D595E	probably damaging	Het
AF067061	A	G	13: 120,264,130	E110G	probably benign	Het
Aldh1l1	T	A	6: 90,559,274	F54I	probably damaging	Het
Arhgap33	C	T	7: 30,523,992	E871K	probably damaging	Het
Aspg	A	T	12: 112,123,396	D456V	possibly damaging	Het
Cacna1b	A	C	2: 24,732,328	S215A	possibly damaging	Het
Car3	A	T	3: 14,866,892	T108S		Het
Ccdc91	C	T	6: 147,510,860	Q23*	probably null	Het
Cd300lg	A	T	11: 102,054,202	I413F	probably damaging	Het
Ces2h	T	A	8: 105,018,124	M378K	probably benign	Het
Cfap44	C	T	16: 44,451,667	T1261I	probably benign	Het
Cir1	G	A	2: 73,287,709	S164L	possibly damaging	Het
Clasp2	A	T	9: 113,896,660	K790*	probably null	Het
Cpne8	A	T	15: 90,572,010	D183E	probably damaging	Het
Dhrs13	A	G	11: 78,032,599	I48V	possibly damaging	Het
Dpp8	G	T	9: 65,074,511	V692L	probably benign	Het
Exoc2	A	T	13: 30,871,855	I660N	probably benign	Het
Exosc5	T	C	7: 25,664,248	V88A	probably benign	Het
Extl3	G	A	14: 65,054,806	T856I	probably damaging	Het
Flnc	T	C	6: 29,456,836	V2277A	probably damaging	Het
Frmd8	A	G	19: 5,873,267	I52T	probably benign	Het
Gm10282	A	G	8: 72,305,109	S25P	probably benign	Het
Gm21671	C	T	5: 25,951,596	M128I	possibly damaging	Het
Gm8947	C	T	1: 151,192,904	R163C	probably benign	Het
Golga7	A	T	8: 23,250,272	C81S	probably damaging	Het
Grik1	A	C	16: 87,896,279	S879A	unknown	Het
Helz	A	G	11: 107,649,159	T1002A	possibly damaging	Het
Hes1	T	A	16: 30,065,907	L62*	probably null	Het
Hnrnpdl	A	T	5: 100,036,560	Y371*	probably null	Het
Ifna11	T	C	4: 88,820,194	V79A	probably benign	Het
Itga4	A	G	2: 79,255,594		probably benign	Het
Kap	T	C	6: 133,850,091	I110V	probably benign	Het
Lmbrd2	A	G	15: 9,172,144	K342E	probably damaging	Het
Lrba	A	G	3: 86,356,666	D1549G	probably damaging	Het
Luzp1	C	T	4: 136,542,922	H819Y	probably damaging	Het
Mmp21	T	A	7: 133,674,271		probably benign	Het
Mto1	T	C	9: 78,470,646	V590A	probably benign	Het
Myom3	T	C	4: 135,764,911	L122P	probably damaging	Het
Nat10	T	C	2: 103,752,593	Y161C	probably damaging	Het
Ncor2	A	G	5: 125,086,875	V197A	unknown	Het
Olfr140	C	A	2: 90,052,351		probably benign	Het
Olfr1445	A	G	19: 12,884,094	Y71C	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,750	D231E	unknown	Het
Olfr530	T	A	7: 140,373,476	I45F	possibly damaging	Het
Olfr680-ps1	C	A	7: 105,091,262	V126L	probably benign	Het
Opn4	A	C	14: 34,592,998	S439R	probably benign	Het
Pik3c2a	G	T	7: 116,418,424	Q33K	probably damaging	Het
Pm20d1	G	T	1: 131,801,115	S93I	possibly damaging	Het
Pou3f1	C	T	4: 124,658,383	A226V	possibly damaging	Het
Ppl	T	C	16: 5,105,951	E191G	probably benign	Het
Prkag1	T	C	15: 98,814,266	T208A	probably benign	Het
Rb1cc1	T	C	1: 6,248,970	I871T	probably benign	Het
Rhd	T	C	4: 134,885,316	S293P	probably damaging	Het
Rprd2	G	T	3: 95,780,584	T252K	probably damaging	Het
Scn5a	C	A	9: 119,534,700	R458L	probably benign	Het
Scrib	C	T	15: 76,061,738		probably null	Het
Serpine3	A	G	14: 62,673,054	R199G	probably benign	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Slc44a1	A	G	4: 53,544,545	K419E	probably damaging	Het
Styxl1	T	C	5: 135,747,780	E318G	probably benign	Het
Tesmin	A	G	19: 3,404,163	K346E	probably damaging	Het
Thpo	A	T	16: 20,728,930	L6Q	unknown	Het
Tlr2	T	A	3: 83,837,768	E336V	probably benign	Het
Tmem167b	A	G	3: 108,560,225	L35P	probably benign	Het
Topaz1	A	T	9: 122,796,036	E1395D	possibly damaging	Het
Trim29	G	T	9: 43,322,339	R434L	possibly damaging	Het
Trim68	T	C	7: 102,678,343	I468V	probably benign	Het
Ttn	C	A	2: 76,712,284	V33453F	probably benign	Het
Ubac1	A	T	2: 26,006,609	V298D	probably damaging	Het
Vmn1r185	C	A	7: 26,611,400	V227F	probably damaging	Het
Vmn1r21	T	A	6: 57,843,844	H205L	probably damaging	Het
Zbtb16	A	G	9: 48,832,557	Y152H	probably benign	Het
Zbtb20	A	T	16: 43,577,605	N19I	probably damaging	Het
Zfp438	A	G	18: 5,213,422	M512T	possibly damaging	Het

Other mutations in Sec24d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Sec24d	APN	3	123350009	missense	probably benign	0.00
IGL01621:Sec24d	APN	3	123294158	critical splice acceptor site	probably null
IGL01866:Sec24d	APN	3	123293595	nonsense	probably null
IGL02064:Sec24d	APN	3	123343814	splice site	probably benign
IGL02125:Sec24d	APN	3	123358958	missense	probably damaging	1.00
IGL02173:Sec24d	APN	3	123353681	missense	probably damaging	1.00
IGL03239:Sec24d	APN	3	123336489	missense	probably benign	0.00
Scanty	UTSW	3	123354947	missense	probably damaging	1.00
3-1:Sec24d	UTSW	3	123353630	missense	possibly damaging	0.94
PIT4531001:Sec24d	UTSW	3	123343178	missense	probably damaging	1.00
R0008:Sec24d	UTSW	3	123350876	splice site	probably benign
R0838:Sec24d	UTSW	3	123305836	missense	probably benign	0.08
R1775:Sec24d	UTSW	3	123336517	missense	probably damaging	1.00
R1895:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R1946:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R2238:Sec24d	UTSW	3	123349894	splice site	probably null
R2504:Sec24d	UTSW	3	123353606	missense	possibly damaging	0.69
R2846:Sec24d	UTSW	3	123350746	missense	probably damaging	0.98
R2895:Sec24d	UTSW	3	123343151	missense	probably damaging	1.00
R3428:Sec24d	UTSW	3	123343923	splice site	probably benign
R4573:Sec24d	UTSW	3	123358870	missense	probably damaging	1.00
R4668:Sec24d	UTSW	3	123355774	missense	probably damaging	0.98
R4706:Sec24d	UTSW	3	123355778	missense	possibly damaging	0.80
R4896:Sec24d	UTSW	3	123354947	missense	probably damaging	1.00
R4982:Sec24d	UTSW	3	123299606	missense	probably benign	0.29
R5030:Sec24d	UTSW	3	123358901	missense	probably damaging	0.98
R5041:Sec24d	UTSW	3	123294231	missense	probably damaging	0.96
R5078:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R5108:Sec24d	UTSW	3	123305785	splice site	probably null
R5174:Sec24d	UTSW	3	123364926	missense	probably damaging	0.99
R5661:Sec24d	UTSW	3	123343085	missense	probably damaging	1.00
R5661:Sec24d	UTSW	3	123343142	missense	possibly damaging	0.95
R5775:Sec24d	UTSW	3	123290460	missense	probably benign	0.00
R5859:Sec24d	UTSW	3	123279312	unclassified	probably benign
R5944:Sec24d	UTSW	3	123293581	missense	probably benign	0.01
R6053:Sec24d	UTSW	3	123279222	nonsense	probably null
R6515:Sec24d	UTSW	3	123343070	missense	possibly damaging	0.92
R6552:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R6557:Sec24d	UTSW	3	123343087	missense	probably damaging	1.00
R6593:Sec24d	UTSW	3	123353412	missense	probably damaging	1.00
R6594:Sec24d	UTSW	3	123293763	missense	probably damaging	1.00
R6842:Sec24d	UTSW	3	123343219	missense	probably benign	0.00
R7072:Sec24d	UTSW	3	123330351	missense	probably damaging	1.00
R7481:Sec24d	UTSW	3	123350763	missense	probably damaging	1.00
R7554:Sec24d	UTSW	3	123355774	missense	probably damaging	1.00
R8270:Sec24d	UTSW	3	123305886	missense	possibly damaging	0.90
R8481:Sec24d	UTSW	3	123353424	missense	probably damaging	1.00
R8713:Sec24d	UTSW	3	123343892	missense	probably damaging	1.00
R8872:Sec24d	UTSW	3	123354936	splice site	probably benign
R8974:Sec24d	UTSW	3	123305849	missense	probably damaging	1.00
R9015:Sec24d	UTSW	3	123327638	missense	probably benign	0.43
R9050:Sec24d	UTSW	3	123350725	missense	probably benign	0.00
R9065:Sec24d	UTSW	3	123355803	missense	probably damaging	1.00
R9128:Sec24d	UTSW	3	123294161	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCCAGTCTACCTATGCAGAG -3'
(R):5'- CCATCTGAAGCAACACATGTG -3'

Sequencing Primer
(F):5'- GCAGAGGGAAAAAATTCCAT -3'
(R):5'- GTGTGCACACATATACTCAAGC -3'

Posted On

2021-08-02