Incidental Mutation 'R8922:Sec24d'
ID 679310
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name Sec24 related gene family, member D (S. cerevisiae)
Synonyms 2310020L09Rik, LOC383951
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8922 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 123267455-123365641 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 123350839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 655 (G655E)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
AlphaFold Q6NXL1
Predicted Effect probably damaging
Transcript: ENSMUST00000047923
AA Change: G655E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: G655E

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik A G 8: 87,568,549 D105G possibly damaging Het
Abhd14b T C 9: 106,451,636 probably null Het
Acot1 C T 12: 84,017,311 Q398* probably null Het
Adam26b A T 8: 43,520,179 D595E probably damaging Het
AF067061 A G 13: 120,264,130 E110G probably benign Het
Aldh1l1 T A 6: 90,559,274 F54I probably damaging Het
Arhgap33 C T 7: 30,523,992 E871K probably damaging Het
Aspg A T 12: 112,123,396 D456V possibly damaging Het
Cacna1b A C 2: 24,732,328 S215A possibly damaging Het
Car3 A T 3: 14,866,892 T108S Het
Ccdc91 C T 6: 147,510,860 Q23* probably null Het
Cd300lg A T 11: 102,054,202 I413F probably damaging Het
Ces2h T A 8: 105,018,124 M378K probably benign Het
Cfap44 C T 16: 44,451,667 T1261I probably benign Het
Cir1 G A 2: 73,287,709 S164L possibly damaging Het
Clasp2 A T 9: 113,896,660 K790* probably null Het
Cpne8 A T 15: 90,572,010 D183E probably damaging Het
Dhrs13 A G 11: 78,032,599 I48V possibly damaging Het
Dpp8 G T 9: 65,074,511 V692L probably benign Het
Exoc2 A T 13: 30,871,855 I660N probably benign Het
Exosc5 T C 7: 25,664,248 V88A probably benign Het
Extl3 G A 14: 65,054,806 T856I probably damaging Het
Flnc T C 6: 29,456,836 V2277A probably damaging Het
Frmd8 A G 19: 5,873,267 I52T probably benign Het
Gm10282 A G 8: 72,305,109 S25P probably benign Het
Gm21671 C T 5: 25,951,596 M128I possibly damaging Het
Gm8947 C T 1: 151,192,904 R163C probably benign Het
Golga7 A T 8: 23,250,272 C81S probably damaging Het
Grik1 A C 16: 87,896,279 S879A unknown Het
Helz A G 11: 107,649,159 T1002A possibly damaging Het
Hes1 T A 16: 30,065,907 L62* probably null Het
Hnrnpdl A T 5: 100,036,560 Y371* probably null Het
Ifna11 T C 4: 88,820,194 V79A probably benign Het
Itga4 A G 2: 79,255,594 probably benign Het
Kap T C 6: 133,850,091 I110V probably benign Het
Lmbrd2 A G 15: 9,172,144 K342E probably damaging Het
Lrba A G 3: 86,356,666 D1549G probably damaging Het
Luzp1 C T 4: 136,542,922 H819Y probably damaging Het
Mmp21 T A 7: 133,674,271 probably benign Het
Mto1 T C 9: 78,470,646 V590A probably benign Het
Myom3 T C 4: 135,764,911 L122P probably damaging Het
Nat10 T C 2: 103,752,593 Y161C probably damaging Het
Ncor2 A G 5: 125,086,875 V197A unknown Het
Olfr140 C A 2: 90,052,351 probably benign Het
Olfr1445 A G 19: 12,884,094 Y71C probably damaging Het
Olfr501-ps1 T A 7: 108,508,750 D231E unknown Het
Olfr530 T A 7: 140,373,476 I45F possibly damaging Het
Olfr680-ps1 C A 7: 105,091,262 V126L probably benign Het
Opn4 A C 14: 34,592,998 S439R probably benign Het
Pik3c2a G T 7: 116,418,424 Q33K probably damaging Het
Pm20d1 G T 1: 131,801,115 S93I possibly damaging Het
Pou3f1 C T 4: 124,658,383 A226V possibly damaging Het
Ppl T C 16: 5,105,951 E191G probably benign Het
Prkag1 T C 15: 98,814,266 T208A probably benign Het
Rb1cc1 T C 1: 6,248,970 I871T probably benign Het
Rhd T C 4: 134,885,316 S293P probably damaging Het
Rprd2 G T 3: 95,780,584 T252K probably damaging Het
Scn5a C A 9: 119,534,700 R458L probably benign Het
Scrib C T 15: 76,061,738 probably null Het
Serpine3 A G 14: 62,673,054 R199G probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Slc44a1 A G 4: 53,544,545 K419E probably damaging Het
Styxl1 T C 5: 135,747,780 E318G probably benign Het
Tesmin A G 19: 3,404,163 K346E probably damaging Het
Thpo A T 16: 20,728,930 L6Q unknown Het
Tlr2 T A 3: 83,837,768 E336V probably benign Het
Tmem167b A G 3: 108,560,225 L35P probably benign Het
Topaz1 A T 9: 122,796,036 E1395D possibly damaging Het
Trim29 G T 9: 43,322,339 R434L possibly damaging Het
Trim68 T C 7: 102,678,343 I468V probably benign Het
Ttn C A 2: 76,712,284 V33453F probably benign Het
Ubac1 A T 2: 26,006,609 V298D probably damaging Het
Vmn1r185 C A 7: 26,611,400 V227F probably damaging Het
Vmn1r21 T A 6: 57,843,844 H205L probably damaging Het
Zbtb16 A G 9: 48,832,557 Y152H probably benign Het
Zbtb20 A T 16: 43,577,605 N19I probably damaging Het
Zfp438 A G 18: 5,213,422 M512T possibly damaging Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
R8270:Sec24d UTSW 3 123305886 missense possibly damaging 0.90
R8481:Sec24d UTSW 3 123353424 missense probably damaging 1.00
R8713:Sec24d UTSW 3 123343892 missense probably damaging 1.00
R8872:Sec24d UTSW 3 123354936 splice site probably benign
R8974:Sec24d UTSW 3 123305849 missense probably damaging 1.00
R9015:Sec24d UTSW 3 123327638 missense probably benign 0.43
R9050:Sec24d UTSW 3 123350725 missense probably benign 0.00
R9065:Sec24d UTSW 3 123355803 missense probably damaging 1.00
R9128:Sec24d UTSW 3 123294161 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCCAGTCTACCTATGCAGAG -3'
(R):5'- CCATCTGAAGCAACACATGTG -3'

Sequencing Primer
(F):5'- GCAGAGGGAAAAAATTCCAT -3'
(R):5'- GTGTGCACACATATACTCAAGC -3'
Posted On 2021-08-02