Incidental Mutation 'R8922:Trim68'
ID679328
Institutional Source Beutler Lab
Gene Symbol Trim68
Ensembl Gene ENSMUSG00000073968
Gene Nametripartite motif-containing 68
SynonymsRnf137, F730114J12Rik, SS-56
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8922 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102677582-102687327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102678343 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 468 (I468V)
Ref Sequence ENSEMBL: ENSMUSP00000080813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082175] [ENSMUST00000210855]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082175
AA Change: I468V

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080813
Gene: ENSMUSG00000073968
AA Change: I468V

DomainStartEndE-ValueType
RING 16 60 1.61e-8 SMART
BBOX 93 134 9.89e-9 SMART
coiled coil region 187 226 N/A INTRINSIC
PRY 302 354 1.91e-24 SMART
SPRY 355 482 3.03e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210855
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif-containing protein family, whose members are characterized by a "really interesting new gene" (RING) finger domain, a zinc-binding B-box motif, and a coiled-coil region. Members of this family function as E3 ubiquitin ligases and are involved in a broad range of biological processes. This gene regulates the activation of nuclear receptors, such as androgen receptor, and has been implicated in development of prostate cancer cells, where its expression increases in response to a downregulation of microRNAs. In addition, this gene participates in viral defense regulation as a negative regulator of interferon-beta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik A G 8: 87,568,549 D105G possibly damaging Het
Abhd14b T C 9: 106,451,636 probably null Het
Acot1 C T 12: 84,017,311 Q398* probably null Het
Adam26b A T 8: 43,520,179 D595E probably damaging Het
AF067061 A G 13: 120,264,130 E110G probably benign Het
Aldh1l1 T A 6: 90,559,274 F54I probably damaging Het
Arhgap33 C T 7: 30,523,992 E871K probably damaging Het
Aspg A T 12: 112,123,396 D456V possibly damaging Het
Cacna1b A C 2: 24,732,328 S215A possibly damaging Het
Car3 A T 3: 14,866,892 T108S Het
Ccdc91 C T 6: 147,510,860 Q23* probably null Het
Cd300lg A T 11: 102,054,202 I413F probably damaging Het
Ces2h T A 8: 105,018,124 M378K probably benign Het
Cfap44 C T 16: 44,451,667 T1261I probably benign Het
Cir1 G A 2: 73,287,709 S164L possibly damaging Het
Clasp2 A T 9: 113,896,660 K790* probably null Het
Cpne8 A T 15: 90,572,010 D183E probably damaging Het
Dhrs13 A G 11: 78,032,599 I48V possibly damaging Het
Dpp8 G T 9: 65,074,511 V692L probably benign Het
Exoc2 A T 13: 30,871,855 I660N probably benign Het
Extl3 G A 14: 65,054,806 T856I probably damaging Het
Flnc T C 6: 29,456,836 V2277A probably damaging Het
Frmd8 A G 19: 5,873,267 I52T probably benign Het
Gm10282 A G 8: 72,305,109 S25P probably benign Het
Gm21671 C T 5: 25,951,596 M128I possibly damaging Het
Gm8947 C T 1: 151,192,904 R163C probably benign Het
Golga7 A T 8: 23,250,272 C81S probably damaging Het
Grik1 A C 16: 87,896,279 S879A unknown Het
Helz A G 11: 107,649,159 T1002A possibly damaging Het
Hes1 T A 16: 30,065,907 L62* probably null Het
Hnrnpdl A T 5: 100,036,560 Y371* probably null Het
Ifna11 T C 4: 88,820,194 V79A probably benign Het
Kap T C 6: 133,850,091 I110V probably benign Het
Lmbrd2 A G 15: 9,172,144 K342E probably damaging Het
Lrba A G 3: 86,356,666 D1549G probably damaging Het
Luzp1 C T 4: 136,542,922 H819Y probably damaging Het
Mto1 T C 9: 78,470,646 V590A probably benign Het
Myom3 T C 4: 135,764,911 L122P probably damaging Het
Nat10 T C 2: 103,752,593 Y161C probably damaging Het
Ncor2 A G 5: 125,086,875 V197A unknown Het
Olfr140 C A 2: 90,052,351 probably benign Het
Olfr1445 A G 19: 12,884,094 Y71C probably damaging Het
Olfr501-ps1 T A 7: 108,508,750 D231E unknown Het
Olfr530 T A 7: 140,373,476 I45F possibly damaging Het
Olfr680-ps1 C A 7: 105,091,262 V126L probably benign Het
Opn4 A C 14: 34,592,998 S439R probably benign Het
Pik3c2a G T 7: 116,418,424 Q33K probably damaging Het
Pm20d1 G T 1: 131,801,115 S93I possibly damaging Het
Pou3f1 C T 4: 124,658,383 A226V possibly damaging Het
Ppl T C 16: 5,105,951 E191G probably benign Het
Prkag1 T C 15: 98,814,266 T208A probably benign Het
Rb1cc1 T C 1: 6,248,970 I871T probably benign Het
Rhd T C 4: 134,885,316 S293P probably damaging Het
Rprd2 G T 3: 95,780,584 T252K probably damaging Het
Scn5a C A 9: 119,534,700 R458L probably benign Het
Scrib C T 15: 76,061,738 probably null Het
Sec24d G A 3: 123,350,839 G655E probably damaging Het
Serpine3 A G 14: 62,673,054 R199G probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Slc44a1 A G 4: 53,544,545 K419E probably damaging Het
Styxl1 T C 5: 135,747,780 E318G probably benign Het
Tesmin A G 19: 3,404,163 K346E probably damaging Het
Thpo A T 16: 20,728,930 L6Q unknown Het
Tlr2 T A 3: 83,837,768 E336V probably benign Het
Tmem167b A G 3: 108,560,225 L35P probably benign Het
Topaz1 A T 9: 122,796,036 E1395D possibly damaging Het
Trim29 G T 9: 43,322,339 R434L possibly damaging Het
Ttn C A 2: 76,712,284 V33453F probably benign Het
Ubac1 A T 2: 26,006,609 V298D probably damaging Het
Vmn1r185 C A 7: 26,611,400 V227F probably damaging Het
Vmn1r21 T A 6: 57,843,844 H205L probably damaging Het
Zbtb16 A G 9: 48,832,557 Y152H probably benign Het
Zbtb20 A T 16: 43,577,605 N19I probably damaging Het
Zfp438 A G 18: 5,213,422 M512T possibly damaging Het
Other mutations in Trim68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Trim68 APN 7 102679141 splice site probably null
IGL02703:Trim68 APN 7 102684079 missense probably damaging 0.99
IGL02835:Trim68 UTSW 7 102678573 missense probably benign 0.21
R1765:Trim68 UTSW 7 102680390 missense possibly damaging 0.82
R1780:Trim68 UTSW 7 102684073 missense possibly damaging 0.58
R4107:Trim68 UTSW 7 102678451 missense probably benign 0.01
R4451:Trim68 UTSW 7 102684473 start codon destroyed probably damaging 1.00
R5385:Trim68 UTSW 7 102678783 missense probably damaging 1.00
R5793:Trim68 UTSW 7 102684353 missense possibly damaging 0.74
R5980:Trim68 UTSW 7 102678831 missense probably damaging 1.00
R6749:Trim68 UTSW 7 102678783 missense probably damaging 0.99
R6912:Trim68 UTSW 7 102684468 missense probably damaging 1.00
R7396:Trim68 UTSW 7 102678362 nonsense probably null
R7789:Trim68 UTSW 7 102684469 missense possibly damaging 0.61
R7892:Trim68 UTSW 7 102678797 missense unknown
R8096:Trim68 UTSW 7 102678442 missense probably damaging 1.00
R8986:Trim68 UTSW 7 102678601 nonsense probably null
R9026:Trim68 UTSW 7 102680240 missense probably damaging 0.96
X0067:Trim68 UTSW 7 102684132 missense probably benign 0.00
Z1176:Trim68 UTSW 7 102678813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCTTATCTCACTGGGACTG -3'
(R):5'- ATGAATATCCGCTCCTGCCC -3'

Sequencing Primer
(F):5'- TTTCTATGAGAGGCACTGACAG -3'
(R):5'- GCTCCTGCCCTTGACAG -3'
Posted On2021-08-02