Incidental Mutation 'R8922:Zbtb16'
ID 679340
Institutional Source Beutler Lab
Gene Symbol Zbtb16
Ensembl Gene ENSMUSG00000066687
Gene Name zinc finger and BTB domain containing 16
Synonyms Green's luxoid, Zfp145, PLZF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.778) question?
Stock # R8922 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 48654297-48836222 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48832557 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 152 (Y152H)
Ref Sequence ENSEMBL: ENSMUSP00000091374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093852] [ENSMUST00000216150]
AlphaFold Q3UQ17
Predicted Effect probably benign
Transcript: ENSMUST00000093852
AA Change: Y152H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091374
Gene: ENSMUSG00000066687
AA Change: Y152H

DomainStartEndE-ValueType
BTB 34 126 1.41e-24 SMART
ZnF_C2H2 404 426 3.72e0 SMART
ZnF_C2H2 432 454 8.22e-2 SMART
ZnF_C2H2 461 483 2.24e-3 SMART
ZnF_C2H2 490 512 1.56e-2 SMART
ZnF_C2H2 518 540 1.63e-5 SMART
ZnF_C2H2 546 568 1.95e-3 SMART
ZnF_C2H2 574 596 5.9e-3 SMART
ZnF_C2H2 602 624 2.36e-2 SMART
ZnF_C2H2 630 652 2.24e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216150
AA Change: Y152H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Krueppel C2H2-type zinc-finger protein family and encodes a zinc finger transcription factor that contains nine Kruppel-type zinc finger domains at the carboxyl terminus. This protein is located in the nucleus, is involved in cell cycle progression, and interacts with a histone deacetylase. Specific instances of aberrant gene rearrangement at this locus have been associated with acute promyelocytic leukemia (APL). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal anterior-posterior patterning, with skeletal abnormalities of the limb, especially the hindlimb, and homeotic transformations of anterior skeletal elements into posterior structures. Males develop infertility due to loss of germline cells with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik A G 8: 87,568,549 D105G possibly damaging Het
Abhd14b T C 9: 106,451,636 probably null Het
Acot1 C T 12: 84,017,311 Q398* probably null Het
Adam26b A T 8: 43,520,179 D595E probably damaging Het
AF067061 A G 13: 120,264,130 E110G probably benign Het
Aldh1l1 T A 6: 90,559,274 F54I probably damaging Het
Arhgap33 C T 7: 30,523,992 E871K probably damaging Het
Aspg A T 12: 112,123,396 D456V possibly damaging Het
Cacna1b A C 2: 24,732,328 S215A possibly damaging Het
Car3 A T 3: 14,866,892 T108S Het
Ccdc91 C T 6: 147,510,860 Q23* probably null Het
Cd300lg A T 11: 102,054,202 I413F probably damaging Het
Ces2h T A 8: 105,018,124 M378K probably benign Het
Cfap44 C T 16: 44,451,667 T1261I probably benign Het
Cir1 G A 2: 73,287,709 S164L possibly damaging Het
Clasp2 A T 9: 113,896,660 K790* probably null Het
Cpne8 A T 15: 90,572,010 D183E probably damaging Het
Dhrs13 A G 11: 78,032,599 I48V possibly damaging Het
Dpp8 G T 9: 65,074,511 V692L probably benign Het
Exoc2 A T 13: 30,871,855 I660N probably benign Het
Exosc5 T C 7: 25,664,248 V88A probably benign Het
Extl3 G A 14: 65,054,806 T856I probably damaging Het
Flnc T C 6: 29,456,836 V2277A probably damaging Het
Frmd8 A G 19: 5,873,267 I52T probably benign Het
Gm10282 A G 8: 72,305,109 S25P probably benign Het
Gm21671 C T 5: 25,951,596 M128I possibly damaging Het
Gm8947 C T 1: 151,192,904 R163C probably benign Het
Golga7 A T 8: 23,250,272 C81S probably damaging Het
Grik1 A C 16: 87,896,279 S879A unknown Het
Helz A G 11: 107,649,159 T1002A possibly damaging Het
Hes1 T A 16: 30,065,907 L62* probably null Het
Hnrnpdl A T 5: 100,036,560 Y371* probably null Het
Ifna11 T C 4: 88,820,194 V79A probably benign Het
Itga4 A G 2: 79,255,594 probably benign Het
Kap T C 6: 133,850,091 I110V probably benign Het
Lmbrd2 A G 15: 9,172,144 K342E probably damaging Het
Lrba A G 3: 86,356,666 D1549G probably damaging Het
Luzp1 C T 4: 136,542,922 H819Y probably damaging Het
Mmp21 T A 7: 133,674,271 probably benign Het
Mto1 T C 9: 78,470,646 V590A probably benign Het
Myom3 T C 4: 135,764,911 L122P probably damaging Het
Nat10 T C 2: 103,752,593 Y161C probably damaging Het
Ncor2 A G 5: 125,086,875 V197A unknown Het
Olfr140 C A 2: 90,052,351 probably benign Het
Olfr1445 A G 19: 12,884,094 Y71C probably damaging Het
Olfr501-ps1 T A 7: 108,508,750 D231E unknown Het
Olfr530 T A 7: 140,373,476 I45F possibly damaging Het
Olfr680-ps1 C A 7: 105,091,262 V126L probably benign Het
Opn4 A C 14: 34,592,998 S439R probably benign Het
Pik3c2a G T 7: 116,418,424 Q33K probably damaging Het
Pm20d1 G T 1: 131,801,115 S93I possibly damaging Het
Pou3f1 C T 4: 124,658,383 A226V possibly damaging Het
Ppl T C 16: 5,105,951 E191G probably benign Het
Prkag1 T C 15: 98,814,266 T208A probably benign Het
Rb1cc1 T C 1: 6,248,970 I871T probably benign Het
Rhd T C 4: 134,885,316 S293P probably damaging Het
Rprd2 G T 3: 95,780,584 T252K probably damaging Het
Scn5a C A 9: 119,534,700 R458L probably benign Het
Scrib C T 15: 76,061,738 probably null Het
Sec24d G A 3: 123,350,839 G655E probably damaging Het
Serpine3 A G 14: 62,673,054 R199G probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Slc44a1 A G 4: 53,544,545 K419E probably damaging Het
Styxl1 T C 5: 135,747,780 E318G probably benign Het
Tesmin A G 19: 3,404,163 K346E probably damaging Het
Thpo A T 16: 20,728,930 L6Q unknown Het
Tlr2 T A 3: 83,837,768 E336V probably benign Het
Tmem167b A G 3: 108,560,225 L35P probably benign Het
Topaz1 A T 9: 122,796,036 E1395D possibly damaging Het
Trim29 G T 9: 43,322,339 R434L possibly damaging Het
Trim68 T C 7: 102,678,343 I468V probably benign Het
Ttn C A 2: 76,712,284 V33453F probably benign Het
Ubac1 A T 2: 26,006,609 V298D probably damaging Het
Vmn1r185 C A 7: 26,611,400 V227F probably damaging Het
Vmn1r21 T A 6: 57,843,844 H205L probably damaging Het
Zbtb20 A T 16: 43,577,605 N19I probably damaging Het
Zfp438 A G 18: 5,213,422 M512T possibly damaging Het
Other mutations in Zbtb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Zbtb16 APN 9 48657183 missense probably damaging 1.00
R0324:Zbtb16 UTSW 9 48665275 missense possibly damaging 0.82
R0364:Zbtb16 UTSW 9 48743576 splice site probably benign
R1538:Zbtb16 UTSW 9 48832283 missense probably benign
R1575:Zbtb16 UTSW 9 48832272 missense probably damaging 0.96
R1937:Zbtb16 UTSW 9 48659778 missense probably benign
R2656:Zbtb16 UTSW 9 48832688 missense probably damaging 1.00
R4176:Zbtb16 UTSW 9 48659801 missense probably damaging 1.00
R4582:Zbtb16 UTSW 9 48832082 missense probably benign
R4595:Zbtb16 UTSW 9 48832080 missense possibly damaging 0.79
R6466:Zbtb16 UTSW 9 48665319 missense possibly damaging 0.95
R6966:Zbtb16 UTSW 9 48657354 missense probably damaging 1.00
R7596:Zbtb16 UTSW 9 48832404 missense possibly damaging 0.93
R7751:Zbtb16 UTSW 9 48743469 missense probably damaging 1.00
R7904:Zbtb16 UTSW 9 48832972 missense probably damaging 1.00
Z1176:Zbtb16 UTSW 9 48657288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGGAGTGACTGTCCTATAC -3'
(R):5'- AGATCCTGGAGTACGCCTACAC -3'

Sequencing Primer
(F):5'- GGAGTGACTGTCCTATACTCATCAAG -3'
(R):5'- TACACGGCCACACTGCAAG -3'
Posted On 2021-08-02