Mutagenetix > Incidental Mutations

Incidental Mutation 'R8922:Exoc2'

679352

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R8922 (G1)

Quality Score

180.009

Status

Validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30871855 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 660 (I660N)

Ref Sequence

ENSEMBL: ENSMUSP00000021785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

PDB Structure

RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000021785
AA Change: I660N

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: I660N

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102946
AA Change: I660N

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: I660N

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Meta Mutation Damage Score

0.0909

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933402J07Rik	A	G	8: 87,568,549	D105G	possibly damaging	Het
Abhd14b	T	C	9: 106,451,636		probably null	Het
Acot1	C	T	12: 84,017,311	Q398*	probably null	Het
Adam26b	A	T	8: 43,520,179	D595E	probably damaging	Het
AF067061	A	G	13: 120,264,130	E110G	probably benign	Het
Aldh1l1	T	A	6: 90,559,274	F54I	probably damaging	Het
Arhgap33	C	T	7: 30,523,992	E871K	probably damaging	Het
Aspg	A	T	12: 112,123,396	D456V	possibly damaging	Het
Cacna1b	A	C	2: 24,732,328	S215A	possibly damaging	Het
Car3	A	T	3: 14,866,892	T108S		Het
Ccdc91	C	T	6: 147,510,860	Q23*	probably null	Het
Cd300lg	A	T	11: 102,054,202	I413F	probably damaging	Het
Ces2h	T	A	8: 105,018,124	M378K	probably benign	Het
Cfap44	C	T	16: 44,451,667	T1261I	probably benign	Het
Cir1	G	A	2: 73,287,709	S164L	possibly damaging	Het
Clasp2	A	T	9: 113,896,660	K790*	probably null	Het
Cpne8	A	T	15: 90,572,010	D183E	probably damaging	Het
Dhrs13	A	G	11: 78,032,599	I48V	possibly damaging	Het
Dpp8	G	T	9: 65,074,511	V692L	probably benign	Het
Exosc5	T	C	7: 25,664,248	V88A	probably benign	Het
Extl3	G	A	14: 65,054,806	T856I	probably damaging	Het
Flnc	T	C	6: 29,456,836	V2277A	probably damaging	Het
Frmd8	A	G	19: 5,873,267	I52T	probably benign	Het
Gm10282	A	G	8: 72,305,109	S25P	probably benign	Het
Gm21671	C	T	5: 25,951,596	M128I	possibly damaging	Het
Gm8947	C	T	1: 151,192,904	R163C	probably benign	Het
Golga7	A	T	8: 23,250,272	C81S	probably damaging	Het
Grik1	A	C	16: 87,896,279	S879A	unknown	Het
Helz	A	G	11: 107,649,159	T1002A	possibly damaging	Het
Hes1	T	A	16: 30,065,907	L62*	probably null	Het
Hnrnpdl	A	T	5: 100,036,560	Y371*	probably null	Het
Ifna11	T	C	4: 88,820,194	V79A	probably benign	Het
Itga4	A	G	2: 79,255,594		probably benign	Het
Kap	T	C	6: 133,850,091	I110V	probably benign	Het
Lmbrd2	A	G	15: 9,172,144	K342E	probably damaging	Het
Lrba	A	G	3: 86,356,666	D1549G	probably damaging	Het
Luzp1	C	T	4: 136,542,922	H819Y	probably damaging	Het
Mmp21	T	A	7: 133,674,271		probably benign	Het
Mto1	T	C	9: 78,470,646	V590A	probably benign	Het
Myom3	T	C	4: 135,764,911	L122P	probably damaging	Het
Nat10	T	C	2: 103,752,593	Y161C	probably damaging	Het
Ncor2	A	G	5: 125,086,875	V197A	unknown	Het
Olfr140	C	A	2: 90,052,351		probably benign	Het
Olfr1445	A	G	19: 12,884,094	Y71C	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,750	D231E	unknown	Het
Olfr530	T	A	7: 140,373,476	I45F	possibly damaging	Het
Olfr680-ps1	C	A	7: 105,091,262	V126L	probably benign	Het
Opn4	A	C	14: 34,592,998	S439R	probably benign	Het
Pik3c2a	G	T	7: 116,418,424	Q33K	probably damaging	Het
Pm20d1	G	T	1: 131,801,115	S93I	possibly damaging	Het
Pou3f1	C	T	4: 124,658,383	A226V	possibly damaging	Het
Ppl	T	C	16: 5,105,951	E191G	probably benign	Het
Prkag1	T	C	15: 98,814,266	T208A	probably benign	Het
Rb1cc1	T	C	1: 6,248,970	I871T	probably benign	Het
Rhd	T	C	4: 134,885,316	S293P	probably damaging	Het
Rprd2	G	T	3: 95,780,584	T252K	probably damaging	Het
Scn5a	C	A	9: 119,534,700	R458L	probably benign	Het
Scrib	C	T	15: 76,061,738		probably null	Het
Sec24d	G	A	3: 123,350,839	G655E	probably damaging	Het
Serpine3	A	G	14: 62,673,054	R199G	probably benign	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Slc44a1	A	G	4: 53,544,545	K419E	probably damaging	Het
Styxl1	T	C	5: 135,747,780	E318G	probably benign	Het
Tesmin	A	G	19: 3,404,163	K346E	probably damaging	Het
Thpo	A	T	16: 20,728,930	L6Q	unknown	Het
Tlr2	T	A	3: 83,837,768	E336V	probably benign	Het
Tmem167b	A	G	3: 108,560,225	L35P	probably benign	Het
Topaz1	A	T	9: 122,796,036	E1395D	possibly damaging	Het
Trim29	G	T	9: 43,322,339	R434L	possibly damaging	Het
Trim68	T	C	7: 102,678,343	I468V	probably benign	Het
Ttn	C	A	2: 76,712,284	V33453F	probably benign	Het
Ubac1	A	T	2: 26,006,609	V298D	probably damaging	Het
Vmn1r185	C	A	7: 26,611,400	V227F	probably damaging	Het
Vmn1r21	T	A	6: 57,843,844	H205L	probably damaging	Het
Zbtb16	A	G	9: 48,832,557	Y152H	probably benign	Het
Zbtb20	A	T	16: 43,577,605	N19I	probably damaging	Het
Zfp438	A	G	18: 5,213,422	M512T	possibly damaging	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTCTGCGATCTAAAGGAACTG -3'
(R):5'- GTACCACCATAGGTAGACAGCC -3'

Sequencing Primer
(F):5'- CTCTGCGATCTAAAGGAACTGAATAC -3'
(R):5'- GAATCCTTCTTCATAGGTCTT -3'

Posted On

2021-08-02