Incidental Mutation 'R8922:Exoc2'
ID 679352
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R8922 (G1)
Quality Score 180.009
Status Validated
Chromosome 13
Chromosomal Location 30813919-30974093 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30871855 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 660 (I660N)
Ref Sequence ENSEMBL: ENSMUSP00000021785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
PDB Structure RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000021785
AA Change: I660N

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: I660N

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102946
AA Change: I660N

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: I660N

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Meta Mutation Damage Score 0.0909 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik A G 8: 87,568,549 D105G possibly damaging Het
Abhd14b T C 9: 106,451,636 probably null Het
Acot1 C T 12: 84,017,311 Q398* probably null Het
Adam26b A T 8: 43,520,179 D595E probably damaging Het
AF067061 A G 13: 120,264,130 E110G probably benign Het
Aldh1l1 T A 6: 90,559,274 F54I probably damaging Het
Arhgap33 C T 7: 30,523,992 E871K probably damaging Het
Aspg A T 12: 112,123,396 D456V possibly damaging Het
Cacna1b A C 2: 24,732,328 S215A possibly damaging Het
Car3 A T 3: 14,866,892 T108S Het
Ccdc91 C T 6: 147,510,860 Q23* probably null Het
Cd300lg A T 11: 102,054,202 I413F probably damaging Het
Ces2h T A 8: 105,018,124 M378K probably benign Het
Cfap44 C T 16: 44,451,667 T1261I probably benign Het
Cir1 G A 2: 73,287,709 S164L possibly damaging Het
Clasp2 A T 9: 113,896,660 K790* probably null Het
Cpne8 A T 15: 90,572,010 D183E probably damaging Het
Dhrs13 A G 11: 78,032,599 I48V possibly damaging Het
Dpp8 G T 9: 65,074,511 V692L probably benign Het
Exosc5 T C 7: 25,664,248 V88A probably benign Het
Extl3 G A 14: 65,054,806 T856I probably damaging Het
Flnc T C 6: 29,456,836 V2277A probably damaging Het
Frmd8 A G 19: 5,873,267 I52T probably benign Het
Gm10282 A G 8: 72,305,109 S25P probably benign Het
Gm21671 C T 5: 25,951,596 M128I possibly damaging Het
Gm8947 C T 1: 151,192,904 R163C probably benign Het
Golga7 A T 8: 23,250,272 C81S probably damaging Het
Grik1 A C 16: 87,896,279 S879A unknown Het
Helz A G 11: 107,649,159 T1002A possibly damaging Het
Hes1 T A 16: 30,065,907 L62* probably null Het
Hnrnpdl A T 5: 100,036,560 Y371* probably null Het
Ifna11 T C 4: 88,820,194 V79A probably benign Het
Itga4 A G 2: 79,255,594 probably benign Het
Kap T C 6: 133,850,091 I110V probably benign Het
Lmbrd2 A G 15: 9,172,144 K342E probably damaging Het
Lrba A G 3: 86,356,666 D1549G probably damaging Het
Luzp1 C T 4: 136,542,922 H819Y probably damaging Het
Mmp21 T A 7: 133,674,271 probably benign Het
Mto1 T C 9: 78,470,646 V590A probably benign Het
Myom3 T C 4: 135,764,911 L122P probably damaging Het
Nat10 T C 2: 103,752,593 Y161C probably damaging Het
Ncor2 A G 5: 125,086,875 V197A unknown Het
Olfr140 C A 2: 90,052,351 probably benign Het
Olfr1445 A G 19: 12,884,094 Y71C probably damaging Het
Olfr501-ps1 T A 7: 108,508,750 D231E unknown Het
Olfr530 T A 7: 140,373,476 I45F possibly damaging Het
Olfr680-ps1 C A 7: 105,091,262 V126L probably benign Het
Opn4 A C 14: 34,592,998 S439R probably benign Het
Pik3c2a G T 7: 116,418,424 Q33K probably damaging Het
Pm20d1 G T 1: 131,801,115 S93I possibly damaging Het
Pou3f1 C T 4: 124,658,383 A226V possibly damaging Het
Ppl T C 16: 5,105,951 E191G probably benign Het
Prkag1 T C 15: 98,814,266 T208A probably benign Het
Rb1cc1 T C 1: 6,248,970 I871T probably benign Het
Rhd T C 4: 134,885,316 S293P probably damaging Het
Rprd2 G T 3: 95,780,584 T252K probably damaging Het
Scn5a C A 9: 119,534,700 R458L probably benign Het
Scrib C T 15: 76,061,738 probably null Het
Sec24d G A 3: 123,350,839 G655E probably damaging Het
Serpine3 A G 14: 62,673,054 R199G probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Slc44a1 A G 4: 53,544,545 K419E probably damaging Het
Styxl1 T C 5: 135,747,780 E318G probably benign Het
Tesmin A G 19: 3,404,163 K346E probably damaging Het
Thpo A T 16: 20,728,930 L6Q unknown Het
Tlr2 T A 3: 83,837,768 E336V probably benign Het
Tmem167b A G 3: 108,560,225 L35P probably benign Het
Topaz1 A T 9: 122,796,036 E1395D possibly damaging Het
Trim29 G T 9: 43,322,339 R434L possibly damaging Het
Trim68 T C 7: 102,678,343 I468V probably benign Het
Ttn C A 2: 76,712,284 V33453F probably benign Het
Ubac1 A T 2: 26,006,609 V298D probably damaging Het
Vmn1r185 C A 7: 26,611,400 V227F probably damaging Het
Vmn1r21 T A 6: 57,843,844 H205L probably damaging Het
Zbtb16 A G 9: 48,832,557 Y152H probably benign Het
Zbtb20 A T 16: 43,577,605 N19I probably damaging Het
Zfp438 A G 18: 5,213,422 M512T possibly damaging Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1367:Exoc2 UTSW 13 30882273 nonsense probably null
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2227:Exoc2 UTSW 13 30864884 missense probably benign
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 30820623 missense probably benign 0.03
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6548:Exoc2 UTSW 13 30826064 missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7613:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7767:Exoc2 UTSW 13 30876769 missense probably benign 0.01
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7795:Exoc2 UTSW 13 30876773 nonsense probably null
R7993:Exoc2 UTSW 13 30906730 critical splice donor site probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8716:Exoc2 UTSW 13 30911244 missense probably damaging 1.00
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R9237:Exoc2 UTSW 13 30864875 missense probably benign
R9243:Exoc2 UTSW 13 30925795 missense probably benign 0.03
R9365:Exoc2 UTSW 13 30856714 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCTGCGATCTAAAGGAACTG -3'
(R):5'- GTACCACCATAGGTAGACAGCC -3'

Sequencing Primer
(F):5'- CTCTGCGATCTAAAGGAACTGAATAC -3'
(R):5'- GAATCCTTCTTCATAGGTCTT -3'
Posted On 2021-08-02