Incidental Mutation 'R8923:Ep400'
ID 679389
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene Name E1A binding protein p400
Synonyms 1700020J09Rik, p400, mDomino
MMRRC Submission 068768-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8923 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110812239-110918583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110831864 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 2126 (L2126P)
Ref Sequence ENSEMBL: ENSMUSP00000049038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000041558
AA Change: L2126P
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: L2126P

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112435
AA Change: L2007P
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: L2007P

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112436
AA Change: L2090P
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: L2090P

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,204,288 (GRCm39) Y308H possibly damaging Het
Ano6 T C 15: 95,811,428 (GRCm39) I176T probably damaging Het
Ap3b2 T C 7: 81,126,931 (GRCm39) E273G probably benign Het
Arid1a A G 4: 133,412,304 (GRCm39) I1245T unknown Het
Ash1l T C 3: 88,892,974 (GRCm39) S1618P possibly damaging Het
Atp5f1e G T 2: 174,304,309 (GRCm39) S49* probably null Het
Bsdc1 C T 4: 129,355,405 (GRCm39) probably benign Het
Ccni T C 5: 93,335,943 (GRCm39) H152R probably damaging Het
Cdk5 A G 5: 24,625,284 (GRCm39) V208A possibly damaging Het
Cmtm5 G A 14: 55,176,345 (GRCm39) D137N probably damaging Het
Cyp3a41b A G 5: 145,521,448 (GRCm39) M1T probably null Het
Cyp3a44 A T 5: 145,736,171 (GRCm39) V93E probably damaging Het
Dhrs2 A T 14: 55,478,309 (GRCm39) I241F probably benign Het
Dip2c A G 13: 9,673,901 (GRCm39) T1114A probably damaging Het
Dsel T C 1: 111,788,284 (GRCm39) I750M possibly damaging Het
Dync2h1 T C 9: 7,168,515 (GRCm39) K398E probably benign Het
Efcab12 G C 6: 115,787,982 (GRCm39) T660S possibly damaging Het
Ercc1 T A 7: 19,081,062 (GRCm39) probably benign Het
Flnc G T 6: 29,452,236 (GRCm39) D1687Y probably damaging Het
Frrs1 A T 3: 116,696,070 (GRCm39) I530F possibly damaging Het
Gp5 G T 16: 30,128,222 (GRCm39) L151I probably damaging Het
H2-Q5 A G 17: 35,613,982 (GRCm39) D177G Het
Itgal A T 7: 126,895,533 (GRCm39) probably benign Het
Klhl33 A T 14: 51,129,882 (GRCm39) C277* probably null Het
Lefty1 T A 1: 180,765,318 (GRCm39) C295* probably null Het
Lmo7 A T 14: 102,137,679 (GRCm39) T794S probably benign Het
Mss51 A G 14: 20,537,177 (GRCm39) M97T possibly damaging Het
Mtmr11 C T 3: 96,072,188 (GRCm39) P262S probably damaging Het
Muc15 A T 2: 110,562,212 (GRCm39) N216I probably damaging Het
Muc16 A T 9: 18,549,972 (GRCm39) D5440E probably benign Het
Myt1l A G 12: 29,960,800 (GRCm39) K1038E unknown Het
Naa15 G A 3: 51,367,443 (GRCm39) V539M probably damaging Het
Or10al2 A T 17: 37,983,702 (GRCm39) I263F probably benign Het
Or1e26 T C 11: 73,480,076 (GRCm39) I163V probably benign Het
Or5ac20 G C 16: 59,104,399 (GRCm39) L154V probably benign Het
Parpbp C T 10: 87,947,474 (GRCm39) V387I probably benign Het
Pbxip1 T C 3: 89,352,921 (GRCm39) I189T possibly damaging Het
Prkci T A 3: 31,095,250 (GRCm39) Y111* probably null Het
Prkd2 C G 7: 16,599,682 (GRCm39) T715R probably damaging Het
Rab40c A C 17: 26,102,664 (GRCm39) S262A probably benign Het
Rad51d A G 11: 82,773,798 (GRCm39) L164P probably damaging Het
Rgs22 T A 15: 36,093,106 (GRCm39) K513I probably damaging Het
Rubcn G T 16: 32,646,049 (GRCm39) T828K probably damaging Het
Sdha G A 13: 74,487,179 (GRCm39) T203M probably damaging Het
Sesn3 T C 9: 14,217,562 (GRCm39) probably null Het
Spag8 T A 4: 43,651,471 (GRCm39) T468S probably damaging Het
Spdl1 T C 11: 34,704,478 (GRCm39) K452E possibly damaging Het
Stat5a T C 11: 100,771,308 (GRCm39) F597S Het
Sult1b1 A C 5: 87,662,893 (GRCm39) F269C probably damaging Het
Ubap1 A G 4: 41,379,170 (GRCm39) N128S probably benign Het
Utp20 G A 10: 88,627,604 (GRCm39) Q954* probably null Het
Vmn1r173 T A 7: 23,401,768 (GRCm39) M1K probably null Het
Wdfy1 A G 1: 79,684,017 (GRCm39) S373P probably benign Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110,835,707 (GRCm39) missense unknown
IGL00585:Ep400 APN 5 110,903,771 (GRCm39) missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110,887,460 (GRCm39) missense probably damaging 1.00
IGL00816:Ep400 APN 5 110,883,356 (GRCm39) unclassified probably benign
IGL01066:Ep400 APN 5 110,816,065 (GRCm39) splice site probably benign
IGL01302:Ep400 APN 5 110,889,914 (GRCm39) missense probably benign 0.00
IGL01568:Ep400 APN 5 110,867,361 (GRCm39) missense unknown
IGL01833:Ep400 APN 5 110,827,874 (GRCm39) missense unknown
IGL02086:Ep400 APN 5 110,824,809 (GRCm39) splice site probably benign
IGL02266:Ep400 APN 5 110,843,163 (GRCm39) unclassified probably benign
IGL02288:Ep400 APN 5 110,831,702 (GRCm39) splice site probably benign
IGL02301:Ep400 APN 5 110,822,826 (GRCm39) missense probably damaging 1.00
IGL02377:Ep400 APN 5 110,868,691 (GRCm39) missense unknown
IGL02382:Ep400 APN 5 110,849,594 (GRCm39) missense unknown
IGL02419:Ep400 APN 5 110,845,242 (GRCm39) splice site probably null
IGL02591:Ep400 APN 5 110,881,638 (GRCm39) unclassified probably benign
IGL02981:Ep400 APN 5 110,839,476 (GRCm39) splice site probably benign
IGL02981:Ep400 APN 5 110,903,969 (GRCm39) missense possibly damaging 0.79
IGL03173:Ep400 APN 5 110,856,737 (GRCm39) unclassified probably benign
IGL03244:Ep400 APN 5 110,875,429 (GRCm39) missense unknown
IGL03333:Ep400 APN 5 110,851,432 (GRCm39) missense unknown
santol UTSW 5 110,849,537 (GRCm39) missense unknown
PIT4243001:Ep400 UTSW 5 110,883,446 (GRCm39) missense unknown
PIT4260001:Ep400 UTSW 5 110,841,037 (GRCm39) nonsense probably null
R0017:Ep400 UTSW 5 110,821,395 (GRCm39) missense probably damaging 1.00
R0179:Ep400 UTSW 5 110,816,515 (GRCm39) missense probably damaging 0.99
R0243:Ep400 UTSW 5 110,872,273 (GRCm39) splice site probably benign
R0366:Ep400 UTSW 5 110,849,537 (GRCm39) missense unknown
R0508:Ep400 UTSW 5 110,887,374 (GRCm39) missense probably benign 0.00
R0541:Ep400 UTSW 5 110,852,882 (GRCm39) missense unknown
R0558:Ep400 UTSW 5 110,832,933 (GRCm39) splice site probably benign
R0576:Ep400 UTSW 5 110,858,959 (GRCm39) unclassified probably benign
R0595:Ep400 UTSW 5 110,851,408 (GRCm39) missense unknown
R0671:Ep400 UTSW 5 110,836,062 (GRCm39) missense unknown
R0763:Ep400 UTSW 5 110,813,703 (GRCm39) missense probably damaging 1.00
R1078:Ep400 UTSW 5 110,883,388 (GRCm39) unclassified probably benign
R1300:Ep400 UTSW 5 110,821,426 (GRCm39) missense probably damaging 1.00
R1439:Ep400 UTSW 5 110,833,344 (GRCm39) missense unknown
R1520:Ep400 UTSW 5 110,839,644 (GRCm39) intron probably benign
R1529:Ep400 UTSW 5 110,887,311 (GRCm39) missense probably benign 0.00
R1535:Ep400 UTSW 5 110,856,032 (GRCm39) unclassified probably benign
R1560:Ep400 UTSW 5 110,818,972 (GRCm39) splice site probably null
R1587:Ep400 UTSW 5 110,874,768 (GRCm39) missense probably benign 0.23
R1596:Ep400 UTSW 5 110,856,727 (GRCm39) unclassified probably benign
R1653:Ep400 UTSW 5 110,841,040 (GRCm39) nonsense probably null
R1711:Ep400 UTSW 5 110,841,174 (GRCm39) unclassified probably benign
R1774:Ep400 UTSW 5 110,833,357 (GRCm39) missense unknown
R1836:Ep400 UTSW 5 110,852,920 (GRCm39) missense unknown
R1905:Ep400 UTSW 5 110,818,814 (GRCm39) missense probably damaging 1.00
R1917:Ep400 UTSW 5 110,851,441 (GRCm39) missense unknown
R2064:Ep400 UTSW 5 110,883,270 (GRCm39) unclassified probably benign
R2122:Ep400 UTSW 5 110,856,716 (GRCm39) unclassified probably benign
R2144:Ep400 UTSW 5 110,851,384 (GRCm39) missense unknown
R2215:Ep400 UTSW 5 110,841,421 (GRCm39) unclassified probably benign
R2252:Ep400 UTSW 5 110,866,957 (GRCm39) missense unknown
R2253:Ep400 UTSW 5 110,866,957 (GRCm39) missense unknown
R2483:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R2504:Ep400 UTSW 5 110,816,511 (GRCm39) missense probably damaging 1.00
R2512:Ep400 UTSW 5 110,856,781 (GRCm39) unclassified probably benign
R2842:Ep400 UTSW 5 110,846,681 (GRCm39) nonsense probably null
R2920:Ep400 UTSW 5 110,903,780 (GRCm39) missense probably damaging 1.00
R3082:Ep400 UTSW 5 110,841,096 (GRCm39) unclassified probably benign
R3151:Ep400 UTSW 5 110,851,435 (GRCm39) missense unknown
R3552:Ep400 UTSW 5 110,877,153 (GRCm39) missense unknown
R3623:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R3779:Ep400 UTSW 5 110,839,515 (GRCm39) missense unknown
R3923:Ep400 UTSW 5 110,904,389 (GRCm39) missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110,889,847 (GRCm39) missense probably benign 0.10
R4508:Ep400 UTSW 5 110,851,481 (GRCm39) missense unknown
R4584:Ep400 UTSW 5 110,881,763 (GRCm39) unclassified probably benign
R4585:Ep400 UTSW 5 110,901,725 (GRCm39) missense probably damaging 1.00
R4586:Ep400 UTSW 5 110,901,725 (GRCm39) missense probably damaging 1.00
R4807:Ep400 UTSW 5 110,843,444 (GRCm39) splice site probably null
R4921:Ep400 UTSW 5 110,813,676 (GRCm39) missense probably damaging 1.00
R4976:Ep400 UTSW 5 110,868,622 (GRCm39) missense unknown
R4976:Ep400 UTSW 5 110,846,678 (GRCm39) missense unknown
R5075:Ep400 UTSW 5 110,833,351 (GRCm39) missense unknown
R5120:Ep400 UTSW 5 110,904,224 (GRCm39) missense probably damaging 1.00
R5122:Ep400 UTSW 5 110,816,036 (GRCm39) missense probably damaging 1.00
R5223:Ep400 UTSW 5 110,816,496 (GRCm39) missense probably damaging 1.00
R5284:Ep400 UTSW 5 110,815,990 (GRCm39) missense probably damaging 1.00
R5388:Ep400 UTSW 5 110,849,594 (GRCm39) missense unknown
R5401:Ep400 UTSW 5 110,831,037 (GRCm39) missense unknown
R5431:Ep400 UTSW 5 110,824,420 (GRCm39) missense unknown
R5461:Ep400 UTSW 5 110,824,550 (GRCm39) nonsense probably null
R5568:Ep400 UTSW 5 110,904,071 (GRCm39) missense probably damaging 1.00
R5650:Ep400 UTSW 5 110,843,818 (GRCm39) critical splice donor site probably null
R5778:Ep400 UTSW 5 110,867,450 (GRCm39) missense unknown
R5806:Ep400 UTSW 5 110,903,420 (GRCm39) nonsense probably null
R5814:Ep400 UTSW 5 110,843,444 (GRCm39) splice site probably null
R5830:Ep400 UTSW 5 110,831,862 (GRCm39) missense unknown
R5882:Ep400 UTSW 5 110,903,453 (GRCm39) missense probably benign 0.00
R5931:Ep400 UTSW 5 110,883,386 (GRCm39) unclassified probably benign
R5945:Ep400 UTSW 5 110,830,732 (GRCm39) missense unknown
R5966:Ep400 UTSW 5 110,824,766 (GRCm39) missense unknown
R5973:Ep400 UTSW 5 110,877,697 (GRCm39) missense unknown
R5980:Ep400 UTSW 5 110,881,595 (GRCm39) unclassified probably benign
R6000:Ep400 UTSW 5 110,831,067 (GRCm39) missense unknown
R6006:Ep400 UTSW 5 110,852,825 (GRCm39) missense unknown
R6053:Ep400 UTSW 5 110,903,661 (GRCm39) missense probably benign 0.22
R6145:Ep400 UTSW 5 110,904,569 (GRCm39) missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110,903,799 (GRCm39) missense probably damaging 0.97
R6169:Ep400 UTSW 5 110,889,863 (GRCm39) missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110,818,808 (GRCm39) missense probably damaging 1.00
R6295:Ep400 UTSW 5 110,901,675 (GRCm39) missense probably benign 0.00
R6486:Ep400 UTSW 5 110,845,084 (GRCm39) unclassified probably benign
R6504:Ep400 UTSW 5 110,856,703 (GRCm39) unclassified probably benign
R6607:Ep400 UTSW 5 110,831,180 (GRCm39) missense unknown
R6657:Ep400 UTSW 5 110,841,411 (GRCm39) unclassified probably benign
R6660:Ep400 UTSW 5 110,867,313 (GRCm39) nonsense probably null
R6741:Ep400 UTSW 5 110,824,761 (GRCm39) missense unknown
R6933:Ep400 UTSW 5 110,813,728 (GRCm39) missense probably damaging 1.00
R6937:Ep400 UTSW 5 110,859,018 (GRCm39) unclassified probably benign
R7069:Ep400 UTSW 5 110,815,990 (GRCm39) missense probably damaging 1.00
R7103:Ep400 UTSW 5 110,881,651 (GRCm39) missense unknown
R7156:Ep400 UTSW 5 110,833,229 (GRCm39) missense unknown
R7272:Ep400 UTSW 5 110,903,511 (GRCm39) nonsense probably null
R7365:Ep400 UTSW 5 110,867,480 (GRCm39) missense unknown
R7581:Ep400 UTSW 5 110,903,891 (GRCm39) missense unknown
R7684:Ep400 UTSW 5 110,845,218 (GRCm39) missense unknown
R7699:Ep400 UTSW 5 110,843,898 (GRCm39) missense unknown
R7700:Ep400 UTSW 5 110,843,898 (GRCm39) missense unknown
R7856:Ep400 UTSW 5 110,814,450 (GRCm39) missense probably damaging 0.99
R7954:Ep400 UTSW 5 110,816,599 (GRCm39) missense possibly damaging 0.46
R8098:Ep400 UTSW 5 110,841,117 (GRCm39) missense unknown
R8108:Ep400 UTSW 5 110,835,749 (GRCm39) missense unknown
R8260:Ep400 UTSW 5 110,903,478 (GRCm39) nonsense probably null
R8293:Ep400 UTSW 5 110,856,758 (GRCm39) missense unknown
R8314:Ep400 UTSW 5 110,903,619 (GRCm39) missense unknown
R8351:Ep400 UTSW 5 110,887,200 (GRCm39) missense probably damaging 1.00
R8424:Ep400 UTSW 5 110,841,144 (GRCm39) missense unknown
R8459:Ep400 UTSW 5 110,856,757 (GRCm39) missense unknown
R8529:Ep400 UTSW 5 110,867,102 (GRCm39) missense unknown
R8688:Ep400 UTSW 5 110,868,685 (GRCm39) missense unknown
R8744:Ep400 UTSW 5 110,889,925 (GRCm39) missense unknown
R9005:Ep400 UTSW 5 110,858,959 (GRCm39) missense unknown
R9087:Ep400 UTSW 5 110,815,430 (GRCm39) nonsense probably null
R9146:Ep400 UTSW 5 110,849,635 (GRCm39) nonsense probably null
R9383:Ep400 UTSW 5 110,833,351 (GRCm39) missense unknown
R9479:Ep400 UTSW 5 110,877,730 (GRCm39) missense unknown
R9496:Ep400 UTSW 5 110,855,853 (GRCm39) missense unknown
R9582:Ep400 UTSW 5 110,824,315 (GRCm39) critical splice donor site probably null
R9607:Ep400 UTSW 5 110,831,805 (GRCm39) missense unknown
R9712:Ep400 UTSW 5 110,904,509 (GRCm39) missense unknown
R9746:Ep400 UTSW 5 110,889,872 (GRCm39) missense unknown
X0012:Ep400 UTSW 5 110,821,062 (GRCm39) small deletion probably benign
X0021:Ep400 UTSW 5 110,830,730 (GRCm39) missense unknown
Z1176:Ep400 UTSW 5 110,904,501 (GRCm39) missense unknown
Z1177:Ep400 UTSW 5 110,881,609 (GRCm39) missense unknown
Z1177:Ep400 UTSW 5 110,831,230 (GRCm39) missense unknown
Z1188:Ep400 UTSW 5 110,903,549 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGACTTAGCCTCTCATCAGCAC -3'
(R):5'- GTGACATGTAGCATGAAGTAAAGCC -3'

Sequencing Primer
(F):5'- TCAGCACAGCAATTCCTGGG -3'
(R):5'- GTAAAGCCTTTGTTGTATCTCACAC -3'
Posted On 2021-08-02