Incidental Mutation 'R8923:Ap3b2'
ID679396
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Nameadaptor-related protein complex 3, beta 2 subunit
Synonymsbeta3B, Naptb
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8923 (G1)
Quality Score181.009
Status Not validated
Chromosome7
Chromosomal Location81460399-81493925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81477183 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 273 (E273G)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
Predicted Effect probably benign
Transcript: ENSMUST00000082090
AA Change: E273G

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: E273G

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152355
AA Change: E273G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,650,551 Y308H possibly damaging Het
Ano6 T C 15: 95,913,547 I176T probably damaging Het
Arid1a A G 4: 133,684,993 I1245T unknown Het
Ash1l T C 3: 88,985,667 S1618P possibly damaging Het
Atp5e G T 2: 174,462,516 S49* probably null Het
AU015836 TGAGGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGA X: 93,969,111 probably benign Het
Bsdc1 C T 4: 129,461,612 probably benign Het
Ccni T C 5: 93,188,084 H152R probably damaging Het
Cdk5 A G 5: 24,420,286 V208A possibly damaging Het
Cmtm5 G A 14: 54,938,888 D137N probably damaging Het
Cyp3a41b A G 5: 145,584,638 M1T probably null Het
Cyp3a44 A T 5: 145,799,361 V93E probably damaging Het
Dhrs2 A T 14: 55,240,852 I241F probably benign Het
Dip2c A G 13: 9,623,865 T1114A probably damaging Het
Dsel T C 1: 111,860,554 I750M possibly damaging Het
Dync2h1 T C 9: 7,168,515 K398E probably benign Het
Efcab12 G C 6: 115,811,021 T660S possibly damaging Het
Ep400 A G 5: 110,683,998 L2126P unknown Het
Flnc G T 6: 29,452,237 D1687Y probably damaging Het
Frrs1 A T 3: 116,902,421 I530F possibly damaging Het
Gp5 G T 16: 30,309,404 L151I probably damaging Het
H2-Q5 A G 17: 35,395,006 D177G Het
Itgal A T 7: 127,296,361 probably benign Het
Klhl33 A T 14: 50,892,425 C277* probably null Het
Lefty1 T A 1: 180,937,753 C295* probably null Het
Lmo7 A T 14: 101,900,243 T794S probably benign Het
Mss51 A G 14: 20,487,109 M97T possibly damaging Het
Mtmr11 C T 3: 96,164,871 P262S probably damaging Het
Muc15 A T 2: 110,731,867 N216I probably damaging Het
Muc16 A T 9: 18,638,676 D5440E probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Naa15 G A 3: 51,460,022 V539M probably damaging Het
Olfr118 A T 17: 37,672,811 I263F probably benign Het
Olfr202 G C 16: 59,284,036 L154V probably benign Het
Olfr385 T C 11: 73,589,250 I163V probably benign Het
Parpbp C T 10: 88,111,612 V387I probably benign Het
Pbxip1 T C 3: 89,445,614 I189T possibly damaging Het
Prkci T A 3: 31,041,101 Y111* probably null Het
Prkd2 C G 7: 16,865,757 T715R probably damaging Het
Rab40c A C 17: 25,883,690 S262A probably benign Het
Rad51d A G 11: 82,882,972 L164P probably damaging Het
Rgs22 T A 15: 36,092,960 K513I probably damaging Het
Rubcn G T 16: 32,825,679 T828K probably damaging Het
Sdha G A 13: 74,339,060 T203M probably damaging Het
Sesn3 T C 9: 14,306,266 probably null Het
Spag8 T A 4: 43,651,471 T468S probably damaging Het
Spdl1 T C 11: 34,813,651 K452E possibly damaging Het
Stat5a T C 11: 100,880,482 F597S Het
Sult1b1 A C 5: 87,515,034 F269C probably damaging Het
Ubap1 A G 4: 41,379,170 N128S probably benign Het
Utp20 G A 10: 88,791,742 Q954* probably null Het
Vmn1r173 T A 7: 23,702,343 M1K probably null Het
Wdfy1 A G 1: 79,706,300 S373P probably benign Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81463911 missense unknown
R1121:Ap3b2 UTSW 7 81464195 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81463690 nonsense probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2354:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3932:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4152:Ap3b2 UTSW 7 81478017 missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81477993 missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 splice site probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81463782 missense unknown
R8273:Ap3b2 UTSW 7 81463242 missense unknown
R8325:Ap3b2 UTSW 7 81484489 splice site probably null
R8355:Ap3b2 UTSW 7 81473103 missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81473035 missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81477153 missense probably benign 0.03
R9002:Ap3b2 UTSW 7 81467444 missense probably benign 0.02
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAAGTAAAGCTGCGCCAC -3'
(R):5'- GCAACCTGCTCATTGATGTGG -3'

Sequencing Primer
(F):5'- CACCGCCATGACCACCG -3'
(R):5'- GGTGATTATCAGCATGCTCACGC -3'
Posted On2021-08-02