Incidental Mutation 'R8923:Ano1'
ID 679398
Institutional Source Beutler Lab
Gene Symbol Ano1
Ensembl Gene ENSMUSG00000031075
Gene Name anoctamin 1, calcium activated chloride channel
Synonyms Tmem16a
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8923 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 144588549-144751974 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144650551 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 308 (Y308H)
Ref Sequence ENSEMBL: ENSMUSP00000112616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758] [ENSMUST00000155175]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033393
AA Change: Y251H

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: Y251H

DomainStartEndE-ValueType
low complexity region 129 147 N/A INTRINSIC
Pfam:Anoctamin 320 898 1.3e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118556
AA Change: Y309H

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: Y309H

DomainStartEndE-ValueType
Pfam:Anoct_dimer 112 375 5.5e-83 PFAM
Pfam:Anoctamin 378 955 6.7e-140 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121758
AA Change: Y308H

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: Y308H

DomainStartEndE-ValueType
Pfam:Anoct_dimer 54 317 7.1e-83 PFAM
Pfam:Anoctamin 320 901 2.2e-139 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119653
Gene: ENSMUSG00000031075
AA Change: Y116H

DomainStartEndE-ValueType
Pfam:Anoct_dimer 2 205 4.4e-64 PFAM
Pfam:Anoctamin 208 335 3e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155175
AA Change: Y275H

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120306
Gene: ENSMUSG00000031075
AA Change: Y275H

DomainStartEndE-ValueType
low complexity region 153 171 N/A INTRINSIC
Meta Mutation Damage Score 0.1331 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano6 T C 15: 95,913,547 I176T probably damaging Het
Ap3b2 T C 7: 81,477,183 E273G probably benign Het
Arid1a A G 4: 133,684,993 I1245T unknown Het
Ash1l T C 3: 88,985,667 S1618P possibly damaging Het
Atp5e G T 2: 174,462,516 S49* probably null Het
Bsdc1 C T 4: 129,461,612 probably benign Het
Ccni T C 5: 93,188,084 H152R probably damaging Het
Cdk5 A G 5: 24,420,286 V208A possibly damaging Het
Cmtm5 G A 14: 54,938,888 D137N probably damaging Het
Cyp3a41b A G 5: 145,584,638 M1T probably null Het
Cyp3a44 A T 5: 145,799,361 V93E probably damaging Het
Dhrs2 A T 14: 55,240,852 I241F probably benign Het
Dip2c A G 13: 9,623,865 T1114A probably damaging Het
Dsel T C 1: 111,860,554 I750M possibly damaging Het
Dync2h1 T C 9: 7,168,515 K398E probably benign Het
Efcab12 G C 6: 115,811,021 T660S possibly damaging Het
Ep400 A G 5: 110,683,998 L2126P unknown Het
Ercc1 T A 7: 19,347,137 probably benign Het
Flnc G T 6: 29,452,237 D1687Y probably damaging Het
Frrs1 A T 3: 116,902,421 I530F possibly damaging Het
Gp5 G T 16: 30,309,404 L151I probably damaging Het
H2-Q5 A G 17: 35,395,006 D177G Het
Itgal A T 7: 127,296,361 probably benign Het
Klhl33 A T 14: 50,892,425 C277* probably null Het
Lefty1 T A 1: 180,937,753 C295* probably null Het
Lmo7 A T 14: 101,900,243 T794S probably benign Het
Mss51 A G 14: 20,487,109 M97T possibly damaging Het
Mtmr11 C T 3: 96,164,871 P262S probably damaging Het
Muc15 A T 2: 110,731,867 N216I probably damaging Het
Muc16 A T 9: 18,638,676 D5440E probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Naa15 G A 3: 51,460,022 V539M probably damaging Het
Olfr118 A T 17: 37,672,811 I263F probably benign Het
Olfr202 G C 16: 59,284,036 L154V probably benign Het
Olfr385 T C 11: 73,589,250 I163V probably benign Het
Parpbp C T 10: 88,111,612 V387I probably benign Het
Pbxip1 T C 3: 89,445,614 I189T possibly damaging Het
Prkci T A 3: 31,041,101 Y111* probably null Het
Prkd2 C G 7: 16,865,757 T715R probably damaging Het
Rab40c A C 17: 25,883,690 S262A probably benign Het
Rad51d A G 11: 82,882,972 L164P probably damaging Het
Rgs22 T A 15: 36,092,960 K513I probably damaging Het
Rubcn G T 16: 32,825,679 T828K probably damaging Het
Sdha G A 13: 74,339,060 T203M probably damaging Het
Sesn3 T C 9: 14,306,266 probably null Het
Spag8 T A 4: 43,651,471 T468S probably damaging Het
Spdl1 T C 11: 34,813,651 K452E possibly damaging Het
Stat5a T C 11: 100,880,482 F597S Het
Sult1b1 A C 5: 87,515,034 F269C probably damaging Het
Ubap1 A G 4: 41,379,170 N128S probably benign Het
Utp20 G A 10: 88,791,742 Q954* probably null Het
Vmn1r173 T A 7: 23,702,343 M1K probably null Het
Wdfy1 A G 1: 79,706,300 S373P probably benign Het
Other mutations in Ano1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ano1 APN 7 144638513 missense probably damaging 1.00
IGL00754:Ano1 APN 7 144597231 missense probably damaging 0.98
IGL00780:Ano1 APN 7 144655630 missense probably damaging 0.99
IGL00918:Ano1 APN 7 144644752 splice site probably benign
IGL01112:Ano1 APN 7 144637145 missense possibly damaging 0.52
IGL01285:Ano1 APN 7 144644742 missense probably benign 0.00
IGL01285:Ano1 APN 7 144595538 missense probably damaging 0.98
IGL01308:Ano1 APN 7 144595498 missense probably damaging 0.99
IGL01407:Ano1 APN 7 144637111 missense probably benign 0.22
IGL01672:Ano1 APN 7 144655675 missense probably damaging 0.96
IGL01920:Ano1 APN 7 144611454 splice site probably benign
IGL01926:Ano1 APN 7 144610875 missense possibly damaging 0.94
IGL02164:Ano1 APN 7 144637181 missense possibly damaging 0.91
IGL02190:Ano1 APN 7 144618883 missense probably benign 0.41
IGL02214:Ano1 APN 7 144655708 missense possibly damaging 0.80
IGL02299:Ano1 APN 7 144590075 missense possibly damaging 0.80
IGL02567:Ano1 APN 7 144611625 missense probably damaging 1.00
IGL03131:Ano1 APN 7 144603585 missense possibly damaging 0.90
IGL03291:Ano1 APN 7 144621675 missense probably damaging 1.00
IGL03299:Ano1 APN 7 144654256 missense probably damaging 1.00
IGL03394:Ano1 APN 7 144595439 splice site probably null
PIT4434001:Ano1 UTSW 7 144610895 missense probably benign 0.28
R0502:Ano1 UTSW 7 144597215 missense probably damaging 1.00
R0595:Ano1 UTSW 7 144590153 missense possibly damaging 0.94
R0732:Ano1 UTSW 7 144619488 critical splice acceptor site probably null
R0970:Ano1 UTSW 7 144595571 missense probably benign 0.02
R0988:Ano1 UTSW 7 144633653 missense possibly damaging 0.94
R1074:Ano1 UTSW 7 144611680 missense probably damaging 0.98
R1301:Ano1 UTSW 7 144633689 missense possibly damaging 0.60
R1528:Ano1 UTSW 7 144595566 missense probably damaging 1.00
R2018:Ano1 UTSW 7 144654250 missense probably damaging 1.00
R2056:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2057:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2058:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2059:Ano1 UTSW 7 144611390 missense probably damaging 1.00
R2860:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R2861:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R3770:Ano1 UTSW 7 144595569 missense probably damaging 1.00
R3970:Ano1 UTSW 7 144607963 missense probably benign 0.00
R4179:Ano1 UTSW 7 144650505 missense probably damaging 1.00
R4489:Ano1 UTSW 7 144611742 missense probably benign 0.00
R4678:Ano1 UTSW 7 144669552 missense probably benign 0.01
R4915:Ano1 UTSW 7 144611375 missense possibly damaging 0.69
R5114:Ano1 UTSW 7 144657083 missense possibly damaging 0.71
R5362:Ano1 UTSW 7 144648600 unclassified probably benign
R5364:Ano1 UTSW 7 144637204 missense probably damaging 1.00
R5366:Ano1 UTSW 7 144654209 missense possibly damaging 0.85
R5387:Ano1 UTSW 7 144648619 missense probably benign
R5762:Ano1 UTSW 7 144648037 missense probably damaging 0.99
R5857:Ano1 UTSW 7 144637103 missense probably benign 0.02
R6091:Ano1 UTSW 7 144669434 missense probably benign 0.12
R6093:Ano1 UTSW 7 144611377 missense possibly damaging 0.72
R6177:Ano1 UTSW 7 144678741 missense possibly damaging 0.79
R6246:Ano1 UTSW 7 144633725 missense possibly damaging 0.82
R6274:Ano1 UTSW 7 144618863 missense probably benign 0.01
R6323:Ano1 UTSW 7 144611686 missense possibly damaging 0.95
R6574:Ano1 UTSW 7 144607916 critical splice donor site probably null
R6782:Ano1 UTSW 7 144621687 missense probably damaging 1.00
R6880:Ano1 UTSW 7 144644742 missense probably benign 0.00
R6909:Ano1 UTSW 7 144655731 missense probably damaging 0.96
R7066:Ano1 UTSW 7 144637086 missense probably benign 0.35
R7073:Ano1 UTSW 7 144638552 missense probably damaging 0.96
R7146:Ano1 UTSW 7 144655656 missense probably benign 0.00
R7420:Ano1 UTSW 7 144655641 missense probably benign 0.00
R7874:Ano1 UTSW 7 144621724 missense probably damaging 1.00
R8468:Ano1 UTSW 7 144655620 missense probably damaging 1.00
R8867:Ano1 UTSW 7 144669660 missense possibly damaging 0.66
R9215:Ano1 UTSW 7 144595605 missense probably damaging 1.00
R9281:Ano1 UTSW 7 144595581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAAAACCCCTGGCTGTAAATCC -3'
(R):5'- GGTGAAGGCTAAGGGTTCTC -3'

Sequencing Primer
(F):5'- CTGGCTGTAAATCCACTGGG -3'
(R):5'- AAGGCTAAGGGTTCTCTGTGACC -3'
Posted On 2021-08-02