Mutagenetix > Incidental Mutation

Incidental Mutation 'R8923:Olfr118'

679423

Institutional Source

Beutler Lab

Gene Symbol

Olfr118

Ensembl Gene

ENSMUSG00000080990

Gene Name

olfactory receptor 118

Synonyms

MOR263-13, GA_x6K02T2PSCP-2131124-2132089

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R8923 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37666988-37673476 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 37672811 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 263 (I263F)

Ref Sequence

ENSEMBL: ENSMUSP00000150176 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]

AlphaFold

Q7TRJ6

Predicted Effect

probably benign
Transcript: ENSMUST00000122036
AA Change: I263F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: I263F

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srv	32	173	2e-6	PFAM
Pfam:7tm_4	37	314	2.1e-57	PFAM
Pfam:7TM_GPCR_Srsx	41	311	5.8e-6	PFAM
Pfam:7tm_1	47	296	1.4e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215811
AA Change: I263F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000216551
AA Change: I263F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano1	A	G	7: 144,650,551	Y308H	possibly damaging	Het
Ano6	T	C	15: 95,913,547	I176T	probably damaging	Het
Ap3b2	T	C	7: 81,477,183	E273G	probably benign	Het
Arid1a	A	G	4: 133,684,993	I1245T	unknown	Het
Ash1l	T	C	3: 88,985,667	S1618P	possibly damaging	Het
Atp5e	G	T	2: 174,462,516	S49*	probably null	Het
Bsdc1	C	T	4: 129,461,612		probably benign	Het
Ccni	T	C	5: 93,188,084	H152R	probably damaging	Het
Cdk5	A	G	5: 24,420,286	V208A	possibly damaging	Het
Cmtm5	G	A	14: 54,938,888	D137N	probably damaging	Het
Cyp3a41b	A	G	5: 145,584,638	M1T	probably null	Het
Cyp3a44	A	T	5: 145,799,361	V93E	probably damaging	Het
Dhrs2	A	T	14: 55,240,852	I241F	probably benign	Het
Dip2c	A	G	13: 9,623,865	T1114A	probably damaging	Het
Dsel	T	C	1: 111,860,554	I750M	possibly damaging	Het
Dync2h1	T	C	9: 7,168,515	K398E	probably benign	Het
Efcab12	G	C	6: 115,811,021	T660S	possibly damaging	Het
Ep400	A	G	5: 110,683,998	L2126P	unknown	Het
Ercc1	T	A	7: 19,347,137		probably benign	Het
Flnc	G	T	6: 29,452,237	D1687Y	probably damaging	Het
Frrs1	A	T	3: 116,902,421	I530F	possibly damaging	Het
Gp5	G	T	16: 30,309,404	L151I	probably damaging	Het
H2-Q5	A	G	17: 35,395,006	D177G		Het
Itgal	A	T	7: 127,296,361		probably benign	Het
Klhl33	A	T	14: 50,892,425	C277*	probably null	Het
Lefty1	T	A	1: 180,937,753	C295*	probably null	Het
Lmo7	A	T	14: 101,900,243	T794S	probably benign	Het
Mss51	A	G	14: 20,487,109	M97T	possibly damaging	Het
Mtmr11	C	T	3: 96,164,871	P262S	probably damaging	Het
Muc15	A	T	2: 110,731,867	N216I	probably damaging	Het
Muc16	A	T	9: 18,638,676	D5440E	probably benign	Het
Myt1l	A	G	12: 29,910,801	K1038E	unknown	Het
Naa15	G	A	3: 51,460,022	V539M	probably damaging	Het
Olfr202	G	C	16: 59,284,036	L154V	probably benign	Het
Olfr385	T	C	11: 73,589,250	I163V	probably benign	Het
Parpbp	C	T	10: 88,111,612	V387I	probably benign	Het
Pbxip1	T	C	3: 89,445,614	I189T	possibly damaging	Het
Prkci	T	A	3: 31,041,101	Y111*	probably null	Het
Prkd2	C	G	7: 16,865,757	T715R	probably damaging	Het
Rab40c	A	C	17: 25,883,690	S262A	probably benign	Het
Rad51d	A	G	11: 82,882,972	L164P	probably damaging	Het
Rgs22	T	A	15: 36,092,960	K513I	probably damaging	Het
Rubcn	G	T	16: 32,825,679	T828K	probably damaging	Het
Sdha	G	A	13: 74,339,060	T203M	probably damaging	Het
Sesn3	T	C	9: 14,306,266		probably null	Het
Spag8	T	A	4: 43,651,471	T468S	probably damaging	Het
Spdl1	T	C	11: 34,813,651	K452E	possibly damaging	Het
Stat5a	T	C	11: 100,880,482	F597S		Het
Sult1b1	A	C	5: 87,515,034	F269C	probably damaging	Het
Ubap1	A	G	4: 41,379,170	N128S	probably benign	Het
Utp20	G	A	10: 88,791,742	Q954*	probably null	Het
Vmn1r173	T	A	7: 23,702,343	M1K	probably null	Het
Wdfy1	A	G	1: 79,706,300	S373P	probably benign	Het

Other mutations in Olfr118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01300:Olfr118	APN	17	37672887	missense	probably damaging	1.00
IGL02456:Olfr118	APN	17	37672449	missense	possibly damaging	0.90
IGL02750:Olfr118	APN	17	37672609	nonsense	probably null
IGL03083:Olfr118	APN	17	37672660	nonsense	probably null
IGL03339:Olfr118	APN	17	37672557	missense	possibly damaging	0.87
R0032:Olfr118	UTSW	17	37672487	missense	probably damaging	1.00
R1457:Olfr118	UTSW	17	37672925	nonsense	probably null
R1542:Olfr118	UTSW	17	37672251	missense	probably damaging	1.00
R1771:Olfr118	UTSW	17	37672663	missense	probably damaging	1.00
R1893:Olfr118	UTSW	17	37672856	nonsense	probably null
R2395:Olfr118	UTSW	17	37672696	nonsense	probably null
R3619:Olfr118	UTSW	17	37672640	missense	probably benign	0.05
R3917:Olfr118	UTSW	17	37672793	missense	probably damaging	1.00
R3937:Olfr118	UTSW	17	37672967	missense	probably benign	0.01
R5600:Olfr118	UTSW	17	37672285	missense	possibly damaging	0.91
R6415:Olfr118	UTSW	17	37672557	missense	possibly damaging	0.87
R6462:Olfr118	UTSW	17	37672220	missense	probably damaging	1.00
R7355:Olfr118	UTSW	17	37672410	missense	probably benign	0.02
R7861:Olfr118	UTSW	17	37672517	missense	possibly damaging	0.91
R7913:Olfr118	UTSW	17	37672108	missense	probably benign
R7952:Olfr118	UTSW	17	37672817	missense	probably damaging	1.00
R7969:Olfr118	UTSW	17	37672656	missense	probably damaging	1.00
R8879:Olfr118	UTSW	17	37672411	nonsense	probably null
R9253:Olfr118	UTSW	17	37672746	missense	probably benign	0.00
R9778:Olfr118	UTSW	17	37672254	missense	probably damaging	0.97
R9789:Olfr118	UTSW	17	37672168	missense	probably damaging	1.00
RF003:Olfr118	UTSW	17	37672858	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGGCTGCAATCTTTGTGGC -3'
(R):5'- TGCACATTTTCATTAGCCAGC -3'

Sequencing Primer
(F):5'- GGCCGTAGTTCTCTGCATATCTAG -3'
(R):5'- AGCTCTGCAAGGTTCTGTTAC -3'

Posted On

2021-08-02