Incidental Mutation 'R8923:Or10al2'
ID 679423
Institutional Source Beutler Lab
Gene Symbol Or10al2
Ensembl Gene ENSMUSG00000080990
Gene Name olfactory receptor family 10 subfamily AL member 2
Synonyms GA_x6K02T2PSCP-2131124-2132089, MOR263-13, Olfr118
MMRRC Submission 068768-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8923 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 37982916-37983888 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37983702 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 263 (I263F)
Ref Sequence ENSEMBL: ENSMUSP00000150176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]
AlphaFold Q7TRJ6
Predicted Effect probably benign
Transcript: ENSMUST00000122036
AA Change: I263F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: I263F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 32 173 2e-6 PFAM
Pfam:7tm_4 37 314 2.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 41 311 5.8e-6 PFAM
Pfam:7tm_1 47 296 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215811
AA Change: I263F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216551
AA Change: I263F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,204,288 (GRCm39) Y308H possibly damaging Het
Ano6 T C 15: 95,811,428 (GRCm39) I176T probably damaging Het
Ap3b2 T C 7: 81,126,931 (GRCm39) E273G probably benign Het
Arid1a A G 4: 133,412,304 (GRCm39) I1245T unknown Het
Ash1l T C 3: 88,892,974 (GRCm39) S1618P possibly damaging Het
Atp5f1e G T 2: 174,304,309 (GRCm39) S49* probably null Het
Bsdc1 C T 4: 129,355,405 (GRCm39) probably benign Het
Ccni T C 5: 93,335,943 (GRCm39) H152R probably damaging Het
Cdk5 A G 5: 24,625,284 (GRCm39) V208A possibly damaging Het
Cmtm5 G A 14: 55,176,345 (GRCm39) D137N probably damaging Het
Cyp3a41b A G 5: 145,521,448 (GRCm39) M1T probably null Het
Cyp3a44 A T 5: 145,736,171 (GRCm39) V93E probably damaging Het
Dhrs2 A T 14: 55,478,309 (GRCm39) I241F probably benign Het
Dip2c A G 13: 9,673,901 (GRCm39) T1114A probably damaging Het
Dsel T C 1: 111,788,284 (GRCm39) I750M possibly damaging Het
Dync2h1 T C 9: 7,168,515 (GRCm39) K398E probably benign Het
Efcab12 G C 6: 115,787,982 (GRCm39) T660S possibly damaging Het
Ep400 A G 5: 110,831,864 (GRCm39) L2126P unknown Het
Ercc1 T A 7: 19,081,062 (GRCm39) probably benign Het
Flnc G T 6: 29,452,236 (GRCm39) D1687Y probably damaging Het
Frrs1 A T 3: 116,696,070 (GRCm39) I530F possibly damaging Het
Gp5 G T 16: 30,128,222 (GRCm39) L151I probably damaging Het
H2-Q5 A G 17: 35,613,982 (GRCm39) D177G Het
Itgal A T 7: 126,895,533 (GRCm39) probably benign Het
Klhl33 A T 14: 51,129,882 (GRCm39) C277* probably null Het
Lefty1 T A 1: 180,765,318 (GRCm39) C295* probably null Het
Lmo7 A T 14: 102,137,679 (GRCm39) T794S probably benign Het
Mss51 A G 14: 20,537,177 (GRCm39) M97T possibly damaging Het
Mtmr11 C T 3: 96,072,188 (GRCm39) P262S probably damaging Het
Muc15 A T 2: 110,562,212 (GRCm39) N216I probably damaging Het
Muc16 A T 9: 18,549,972 (GRCm39) D5440E probably benign Het
Myt1l A G 12: 29,960,800 (GRCm39) K1038E unknown Het
Naa15 G A 3: 51,367,443 (GRCm39) V539M probably damaging Het
Or1e26 T C 11: 73,480,076 (GRCm39) I163V probably benign Het
Or5ac20 G C 16: 59,104,399 (GRCm39) L154V probably benign Het
Parpbp C T 10: 87,947,474 (GRCm39) V387I probably benign Het
Pbxip1 T C 3: 89,352,921 (GRCm39) I189T possibly damaging Het
Prkci T A 3: 31,095,250 (GRCm39) Y111* probably null Het
Prkd2 C G 7: 16,599,682 (GRCm39) T715R probably damaging Het
Rab40c A C 17: 26,102,664 (GRCm39) S262A probably benign Het
Rad51d A G 11: 82,773,798 (GRCm39) L164P probably damaging Het
Rgs22 T A 15: 36,093,106 (GRCm39) K513I probably damaging Het
Rubcn G T 16: 32,646,049 (GRCm39) T828K probably damaging Het
Sdha G A 13: 74,487,179 (GRCm39) T203M probably damaging Het
Sesn3 T C 9: 14,217,562 (GRCm39) probably null Het
Spag8 T A 4: 43,651,471 (GRCm39) T468S probably damaging Het
Spdl1 T C 11: 34,704,478 (GRCm39) K452E possibly damaging Het
Stat5a T C 11: 100,771,308 (GRCm39) F597S Het
Sult1b1 A C 5: 87,662,893 (GRCm39) F269C probably damaging Het
Ubap1 A G 4: 41,379,170 (GRCm39) N128S probably benign Het
Utp20 G A 10: 88,627,604 (GRCm39) Q954* probably null Het
Vmn1r173 T A 7: 23,401,768 (GRCm39) M1K probably null Het
Wdfy1 A G 1: 79,684,017 (GRCm39) S373P probably benign Het
Other mutations in Or10al2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Or10al2 APN 17 37,983,778 (GRCm39) missense probably damaging 1.00
IGL02456:Or10al2 APN 17 37,983,340 (GRCm39) missense possibly damaging 0.90
IGL02750:Or10al2 APN 17 37,983,500 (GRCm39) nonsense probably null
IGL03083:Or10al2 APN 17 37,983,551 (GRCm39) nonsense probably null
IGL03339:Or10al2 APN 17 37,983,448 (GRCm39) missense possibly damaging 0.87
R0032:Or10al2 UTSW 17 37,983,378 (GRCm39) missense probably damaging 1.00
R1457:Or10al2 UTSW 17 37,983,816 (GRCm39) nonsense probably null
R1542:Or10al2 UTSW 17 37,983,142 (GRCm39) missense probably damaging 1.00
R1771:Or10al2 UTSW 17 37,983,554 (GRCm39) missense probably damaging 1.00
R1893:Or10al2 UTSW 17 37,983,747 (GRCm39) nonsense probably null
R2395:Or10al2 UTSW 17 37,983,587 (GRCm39) nonsense probably null
R3619:Or10al2 UTSW 17 37,983,531 (GRCm39) missense probably benign 0.05
R3917:Or10al2 UTSW 17 37,983,684 (GRCm39) missense probably damaging 1.00
R3937:Or10al2 UTSW 17 37,983,858 (GRCm39) missense probably benign 0.01
R5600:Or10al2 UTSW 17 37,983,176 (GRCm39) missense possibly damaging 0.91
R6415:Or10al2 UTSW 17 37,983,448 (GRCm39) missense possibly damaging 0.87
R6462:Or10al2 UTSW 17 37,983,111 (GRCm39) missense probably damaging 1.00
R7355:Or10al2 UTSW 17 37,983,301 (GRCm39) missense probably benign 0.02
R7861:Or10al2 UTSW 17 37,983,408 (GRCm39) missense possibly damaging 0.91
R7913:Or10al2 UTSW 17 37,982,999 (GRCm39) missense probably benign
R7952:Or10al2 UTSW 17 37,983,708 (GRCm39) missense probably damaging 1.00
R7969:Or10al2 UTSW 17 37,983,547 (GRCm39) missense probably damaging 1.00
R8879:Or10al2 UTSW 17 37,983,302 (GRCm39) nonsense probably null
R9253:Or10al2 UTSW 17 37,983,637 (GRCm39) missense probably benign 0.00
R9778:Or10al2 UTSW 17 37,983,145 (GRCm39) missense probably damaging 0.97
R9789:Or10al2 UTSW 17 37,983,059 (GRCm39) missense probably damaging 1.00
RF003:Or10al2 UTSW 17 37,983,749 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCTGCAATCTTTGTGGC -3'
(R):5'- TGCACATTTTCATTAGCCAGC -3'

Sequencing Primer
(F):5'- GGCCGTAGTTCTCTGCATATCTAG -3'
(R):5'- AGCTCTGCAAGGTTCTGTTAC -3'
Posted On 2021-08-02