Incidental Mutation 'R8923:Olfr118'
ID 679423
Institutional Source Beutler Lab
Gene Symbol Olfr118
Ensembl Gene ENSMUSG00000080990
Gene Name olfactory receptor 118
Synonyms MOR263-13, GA_x6K02T2PSCP-2131124-2132089
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R8923 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 37666988-37673476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37672811 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 263 (I263F)
Ref Sequence ENSEMBL: ENSMUSP00000150176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]
AlphaFold Q7TRJ6
Predicted Effect probably benign
Transcript: ENSMUST00000122036
AA Change: I263F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: I263F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 32 173 2e-6 PFAM
Pfam:7tm_4 37 314 2.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 41 311 5.8e-6 PFAM
Pfam:7tm_1 47 296 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215811
AA Change: I263F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216551
AA Change: I263F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,650,551 Y308H possibly damaging Het
Ano6 T C 15: 95,913,547 I176T probably damaging Het
Ap3b2 T C 7: 81,477,183 E273G probably benign Het
Arid1a A G 4: 133,684,993 I1245T unknown Het
Ash1l T C 3: 88,985,667 S1618P possibly damaging Het
Atp5e G T 2: 174,462,516 S49* probably null Het
Bsdc1 C T 4: 129,461,612 probably benign Het
Ccni T C 5: 93,188,084 H152R probably damaging Het
Cdk5 A G 5: 24,420,286 V208A possibly damaging Het
Cmtm5 G A 14: 54,938,888 D137N probably damaging Het
Cyp3a41b A G 5: 145,584,638 M1T probably null Het
Cyp3a44 A T 5: 145,799,361 V93E probably damaging Het
Dhrs2 A T 14: 55,240,852 I241F probably benign Het
Dip2c A G 13: 9,623,865 T1114A probably damaging Het
Dsel T C 1: 111,860,554 I750M possibly damaging Het
Dync2h1 T C 9: 7,168,515 K398E probably benign Het
Efcab12 G C 6: 115,811,021 T660S possibly damaging Het
Ep400 A G 5: 110,683,998 L2126P unknown Het
Ercc1 T A 7: 19,347,137 probably benign Het
Flnc G T 6: 29,452,237 D1687Y probably damaging Het
Frrs1 A T 3: 116,902,421 I530F possibly damaging Het
Gp5 G T 16: 30,309,404 L151I probably damaging Het
H2-Q5 A G 17: 35,395,006 D177G Het
Itgal A T 7: 127,296,361 probably benign Het
Klhl33 A T 14: 50,892,425 C277* probably null Het
Lefty1 T A 1: 180,937,753 C295* probably null Het
Lmo7 A T 14: 101,900,243 T794S probably benign Het
Mss51 A G 14: 20,487,109 M97T possibly damaging Het
Mtmr11 C T 3: 96,164,871 P262S probably damaging Het
Muc15 A T 2: 110,731,867 N216I probably damaging Het
Muc16 A T 9: 18,638,676 D5440E probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Naa15 G A 3: 51,460,022 V539M probably damaging Het
Olfr202 G C 16: 59,284,036 L154V probably benign Het
Olfr385 T C 11: 73,589,250 I163V probably benign Het
Parpbp C T 10: 88,111,612 V387I probably benign Het
Pbxip1 T C 3: 89,445,614 I189T possibly damaging Het
Prkci T A 3: 31,041,101 Y111* probably null Het
Prkd2 C G 7: 16,865,757 T715R probably damaging Het
Rab40c A C 17: 25,883,690 S262A probably benign Het
Rad51d A G 11: 82,882,972 L164P probably damaging Het
Rgs22 T A 15: 36,092,960 K513I probably damaging Het
Rubcn G T 16: 32,825,679 T828K probably damaging Het
Sdha G A 13: 74,339,060 T203M probably damaging Het
Sesn3 T C 9: 14,306,266 probably null Het
Spag8 T A 4: 43,651,471 T468S probably damaging Het
Spdl1 T C 11: 34,813,651 K452E possibly damaging Het
Stat5a T C 11: 100,880,482 F597S Het
Sult1b1 A C 5: 87,515,034 F269C probably damaging Het
Ubap1 A G 4: 41,379,170 N128S probably benign Het
Utp20 G A 10: 88,791,742 Q954* probably null Het
Vmn1r173 T A 7: 23,702,343 M1K probably null Het
Wdfy1 A G 1: 79,706,300 S373P probably benign Het
Other mutations in Olfr118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Olfr118 APN 17 37672887 missense probably damaging 1.00
IGL02456:Olfr118 APN 17 37672449 missense possibly damaging 0.90
IGL02750:Olfr118 APN 17 37672609 nonsense probably null
IGL03083:Olfr118 APN 17 37672660 nonsense probably null
IGL03339:Olfr118 APN 17 37672557 missense possibly damaging 0.87
R0032:Olfr118 UTSW 17 37672487 missense probably damaging 1.00
R1457:Olfr118 UTSW 17 37672925 nonsense probably null
R1542:Olfr118 UTSW 17 37672251 missense probably damaging 1.00
R1771:Olfr118 UTSW 17 37672663 missense probably damaging 1.00
R1893:Olfr118 UTSW 17 37672856 nonsense probably null
R2395:Olfr118 UTSW 17 37672696 nonsense probably null
R3619:Olfr118 UTSW 17 37672640 missense probably benign 0.05
R3917:Olfr118 UTSW 17 37672793 missense probably damaging 1.00
R3937:Olfr118 UTSW 17 37672967 missense probably benign 0.01
R5600:Olfr118 UTSW 17 37672285 missense possibly damaging 0.91
R6415:Olfr118 UTSW 17 37672557 missense possibly damaging 0.87
R6462:Olfr118 UTSW 17 37672220 missense probably damaging 1.00
R7355:Olfr118 UTSW 17 37672410 missense probably benign 0.02
R7861:Olfr118 UTSW 17 37672517 missense possibly damaging 0.91
R7913:Olfr118 UTSW 17 37672108 missense probably benign
R7952:Olfr118 UTSW 17 37672817 missense probably damaging 1.00
R7969:Olfr118 UTSW 17 37672656 missense probably damaging 1.00
R8879:Olfr118 UTSW 17 37672411 nonsense probably null
R9253:Olfr118 UTSW 17 37672746 missense probably benign 0.00
R9778:Olfr118 UTSW 17 37672254 missense probably damaging 0.97
R9789:Olfr118 UTSW 17 37672168 missense probably damaging 1.00
RF003:Olfr118 UTSW 17 37672858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCTGCAATCTTTGTGGC -3'
(R):5'- TGCACATTTTCATTAGCCAGC -3'

Sequencing Primer
(F):5'- GGCCGTAGTTCTCTGCATATCTAG -3'
(R):5'- AGCTCTGCAAGGTTCTGTTAC -3'
Posted On 2021-08-02