Incidental Mutation 'R8924:Dnajc16'
ID 679446
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 2900037O03Rik, 4732437J24Rik
MMRRC Submission 068769-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.724) question?
Stock # R8924 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 141487500-141518242 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 141494018 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 543 (S543*)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000038014
AA Change: S543*
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: S543*

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (88/90)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,838,003 (GRCm39) V1145A probably benign Het
Ank1 T C 8: 23,589,011 (GRCm39) M562T probably benign Het
Atn1 A T 6: 124,722,211 (GRCm39) S881T probably benign Het
B3galt1 C T 2: 67,949,059 (GRCm39) T258I probably benign Het
Bahcc1 C T 11: 120,167,591 (GRCm39) L1331F probably benign Het
Capn12 G A 7: 28,582,628 (GRCm39) V168M probably damaging Het
Card14 T C 11: 119,216,930 (GRCm39) V338A possibly damaging Het
Cd27 T C 6: 125,213,432 (GRCm39) probably benign Het
Cd37 A G 7: 44,888,109 (GRCm39) L37P probably damaging Het
Cd96 A G 16: 45,919,385 (GRCm39) L212P probably damaging Het
Celsr1 T C 15: 85,916,671 (GRCm39) E434G possibly damaging Het
Cep152 A G 2: 125,444,778 (GRCm39) M456T possibly damaging Het
Ces3b G A 8: 105,811,619 (GRCm39) R45H probably benign Het
Cfap54 T G 10: 92,837,685 (GRCm39) T1072P probably damaging Het
Chodl A T 16: 78,738,659 (GRCm39) M172L possibly damaging Het
Cilp2 A G 8: 70,339,108 (GRCm39) S47P probably damaging Het
Clasrp T C 7: 19,318,232 (GRCm39) I596V unknown Het
Clcn2 C T 16: 20,530,930 (GRCm39) V267I probably damaging Het
Cntln T A 4: 84,806,936 (GRCm39) D139E probably damaging Het
Cyp2j12 A C 4: 95,994,685 (GRCm39) N379K probably damaging Het
Defb21 T C 2: 152,416,704 (GRCm39) V60A possibly damaging Het
Efcab12 G T 6: 115,800,664 (GRCm39) H120N probably benign Het
Efcab3 AACTCTA AA 11: 104,806,253 (GRCm39) probably null Het
Efl1 G A 7: 82,412,161 (GRCm39) G850D probably benign Het
Efna1 T C 3: 89,183,635 (GRCm39) M64V probably benign Het
Eif2ak3 T C 6: 70,870,003 (GRCm39) W897R probably damaging Het
Eif2ak4 T A 2: 118,258,513 (GRCm39) F621Y probably damaging Het
Erbin C A 13: 103,975,966 (GRCm39) E643* probably null Het
Esr1 G A 10: 4,807,176 (GRCm39) W364* probably null Het
Fam171a2 T C 11: 102,330,861 (GRCm39) E206G possibly damaging Het
Fam90a1a T C 8: 22,451,429 (GRCm39) F97L probably benign Het
Fap A T 2: 62,378,165 (GRCm39) F181I probably benign Het
Fem1b T C 9: 62,704,916 (GRCm39) N115D probably damaging Het
Gal3st2b G T 1: 93,868,653 (GRCm39) A295S probably benign Het
Galnt10 G A 11: 57,674,681 (GRCm39) probably benign Het
Gcfc2 T C 6: 81,909,879 (GRCm39) V224A probably damaging Het
Gh T C 11: 106,191,634 (GRCm39) E136G probably damaging Het
Gjd3 C T 11: 98,873,325 (GRCm39) C173Y probably damaging Het
Gm12695 T A 4: 96,651,046 (GRCm39) M136L probably benign Het
Gnas A G 2: 174,141,277 (GRCm39) E482G unknown Het
Gpa33 T C 1: 165,980,351 (GRCm39) L138P probably damaging Het
Hlf T C 11: 90,236,714 (GRCm39) D181G probably damaging Het
Irgm1 A G 11: 48,756,698 (GRCm39) L387S probably benign Het
Kctd1 T C 18: 15,102,745 (GRCm39) E812G possibly damaging Het
Klra2 T C 6: 131,205,214 (GRCm39) E209G probably benign Het
Klra3 C T 6: 130,312,732 (GRCm39) V11M probably benign Het
Klrh1 G T 6: 129,745,084 (GRCm39) H171N probably benign Het
Kmt2c T C 5: 25,503,885 (GRCm39) S3808G probably benign Het
Krtap24-1 A C 16: 88,408,888 (GRCm39) S79R probably benign Het
Limch1 T A 5: 67,190,475 (GRCm39) H759Q probably benign Het
Map3k4 A G 17: 12,490,433 (GRCm39) Y333H probably benign Het
Mmel1 A G 4: 154,974,091 (GRCm39) Y377C probably damaging Het
Ms4a14 A T 19: 11,281,113 (GRCm39) Y482N possibly damaging Het
Myo9b A G 8: 71,801,675 (GRCm39) S1277G probably benign Het
Nab1 T C 1: 52,529,667 (GRCm39) T77A possibly damaging Het
Obsl1 T C 1: 75,482,841 (GRCm39) S10G probably benign Het
Odc1 A G 12: 17,598,329 (GRCm39) T157A possibly damaging Het
Or2a5 T G 6: 42,873,964 (GRCm39) L193R probably damaging Het
Or8b52 T C 9: 38,576,780 (GRCm39) D120G probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Plpp1 T A 13: 112,943,057 (GRCm39) probably benign Het
Prdm13 G A 4: 21,679,125 (GRCm39) A455V possibly damaging Het
Ptpn13 A T 5: 103,739,101 (GRCm39) Y2289F probably damaging Het
Ptpn18 G T 1: 34,498,966 (GRCm39) R21L probably benign Het
Ptprd A G 4: 75,916,736 (GRCm39) probably null Het
Rcn3 G T 7: 44,733,095 (GRCm39) D258E probably damaging Het
Ro60 C T 1: 143,641,170 (GRCm39) probably null Het
Rsf1 GCG GCGACGGCGCCG 7: 97,229,114 (GRCm39) probably benign Het
Sacs T A 14: 61,429,895 (GRCm39) H651Q probably benign Het
Sacs T C 14: 61,448,702 (GRCm39) S3583P probably damaging Het
Scel A G 14: 103,829,807 (GRCm39) N463S possibly damaging Het
Serpinb2 A T 1: 107,443,284 (GRCm39) I28F possibly damaging Het
Sin3b A G 8: 73,473,131 (GRCm39) K484E probably benign Het
Snrnp48 T A 13: 38,400,397 (GRCm39) V168D probably damaging Het
Snx18 T G 13: 113,754,931 (GRCm39) M1L probably benign Het
Spata31h1 T C 10: 82,131,295 (GRCm39) N572D probably benign Het
Srcap T A 7: 127,158,204 (GRCm39) N2693K unknown Het
Stim1 A G 7: 102,078,014 (GRCm39) D172G Het
Stip1 A T 19: 7,002,687 (GRCm39) L414H probably damaging Het
Sun1 A G 5: 139,209,390 (GRCm39) H40R probably damaging Het
Sva T A 6: 42,019,182 (GRCm39) D117E possibly damaging Het
Syne2 A G 12: 75,943,444 (GRCm39) D321G probably damaging Het
Trim45 A G 3: 100,835,394 (GRCm39) D459G probably damaging Het
Ttc6 G A 12: 57,697,790 (GRCm39) W43* probably null Het
Ugt2b35 A G 5: 87,152,780 (GRCm39) T317A possibly damaging Het
Usp32 C T 11: 84,916,370 (GRCm39) R858Q probably damaging Het
Vmn2r53 G T 7: 12,334,752 (GRCm39) Q303K probably benign Het
Yeats2 T C 16: 19,969,312 (GRCm39) probably null Het
Zfp804a A G 2: 82,088,747 (GRCm39) N859D probably benign Het
Zscan10 A T 17: 23,824,580 (GRCm39) Q12L possibly damaging Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141,490,874 (GRCm39) splice site probably null
IGL00840:Dnajc16 APN 4 141,495,314 (GRCm39) missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141,491,008 (GRCm39) missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141,501,940 (GRCm39) missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141,504,244 (GRCm39) missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141,491,958 (GRCm39) missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141,495,043 (GRCm39) nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141,498,260 (GRCm39) missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141,491,996 (GRCm39) missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141,495,318 (GRCm39) missense probably benign
R0415:Dnajc16 UTSW 4 141,516,359 (GRCm39) nonsense probably null
R0532:Dnajc16 UTSW 4 141,516,320 (GRCm39) missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141,495,052 (GRCm39) nonsense probably null
R2959:Dnajc16 UTSW 4 141,493,856 (GRCm39) nonsense probably null
R3025:Dnajc16 UTSW 4 141,501,922 (GRCm39) missense probably benign
R3796:Dnajc16 UTSW 4 141,495,048 (GRCm39) missense probably benign
R3854:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R3856:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R4661:Dnajc16 UTSW 4 141,490,859 (GRCm39) missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141,495,280 (GRCm39) nonsense probably null
R5126:Dnajc16 UTSW 4 141,501,820 (GRCm39) missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141,491,994 (GRCm39) missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141,502,703 (GRCm39) missense probably benign
R6888:Dnajc16 UTSW 4 141,504,303 (GRCm39) missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141,494,001 (GRCm39) missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141,491,124 (GRCm39) missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141,501,879 (GRCm39) missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141,492,002 (GRCm39) missense possibly damaging 0.87
R9005:Dnajc16 UTSW 4 141,491,945 (GRCm39) missense possibly damaging 0.95
R9053:Dnajc16 UTSW 4 141,510,371 (GRCm39) missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141,495,058 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGAAGCTCGGCTCAGTCTTC -3'
(R):5'- GTCAGCTGAAAGCCAGATCC -3'

Sequencing Primer
(F):5'- AGCCTTCTCGGGGACTTC -3'
(R):5'- AAGCCAGATCCCGAGGTTGTG -3'
Posted On 2021-08-02