Incidental Mutation 'R8924:Vmn2r53'
ID 679463
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R8924 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 12581470-12606544 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 12600825 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 303 (Q303K)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect probably benign
Transcript: ENSMUST00000170412
AA Change: Q303K

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: Q303K

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (88/90)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,295,461 N572D probably benign Het
Abca8b A G 11: 109,947,177 V1145A probably benign Het
Ank1 T C 8: 23,098,995 M562T probably benign Het
Atn1 A T 6: 124,745,248 S881T probably benign Het
B3galt1 C T 2: 68,118,715 T258I probably benign Het
Bahcc1 C T 11: 120,276,765 L1331F probably benign Het
Capn12 G A 7: 28,883,203 V168M probably damaging Het
Card14 T C 11: 119,326,104 V338A possibly damaging Het
Cd27 T C 6: 125,236,469 probably benign Het
Cd37 A G 7: 45,238,685 L37P probably damaging Het
Cd96 A G 16: 46,099,022 L212P probably damaging Het
Celsr1 T C 15: 86,032,470 E434G possibly damaging Het
Cep152 A G 2: 125,602,858 M456T possibly damaging Het
Ces3b G A 8: 105,084,987 R45H probably benign Het
Cfap54 T G 10: 93,001,823 T1072P probably damaging Het
Chodl A T 16: 78,941,771 M172L possibly damaging Het
Cilp2 A G 8: 69,886,458 S47P probably damaging Het
Clasrp T C 7: 19,584,307 I596V unknown Het
Clcn2 C T 16: 20,712,180 V267I probably damaging Het
Cntln T A 4: 84,888,699 D139E probably damaging Het
Cyp2j12 A C 4: 96,106,448 N379K probably damaging Het
Defb21 T C 2: 152,574,784 V60A possibly damaging Het
Dnajc16 G T 4: 141,766,707 S543* probably null Het
Efcab12 G T 6: 115,823,703 H120N probably benign Het
Efl1 G A 7: 82,762,953 G850D probably benign Het
Efna1 T C 3: 89,276,328 M64V probably benign Het
Eif2ak3 T C 6: 70,893,019 W897R probably damaging Het
Eif2ak4 T A 2: 118,428,032 F621Y probably damaging Het
Erbin C A 13: 103,839,458 E643* probably null Het
Esr1 G A 10: 4,857,176 W364* probably null Het
Fam171a2 T C 11: 102,440,035 E206G possibly damaging Het
Fam90a1a T C 8: 21,961,413 F97L probably benign Het
Fap A T 2: 62,547,821 F181I probably benign Het
Fem1b T C 9: 62,797,634 N115D probably damaging Het
Gal3st2b G T 1: 93,940,931 A295S probably benign Het
Galnt10 G A 11: 57,783,855 probably benign Het
Gcfc2 T C 6: 81,932,898 V224A probably damaging Het
Gh T C 11: 106,300,808 E136G probably damaging Het
Gjd3 C T 11: 98,982,499 C173Y probably damaging Het
Gm11639 AACTCTA AA 11: 104,915,427 probably null Het
Gm12695 T A 4: 96,762,809 M136L probably benign Het
Gm156 G T 6: 129,768,121 H171N probably benign Het
Gnas A G 2: 174,299,484 E482G unknown Het
Gpa33 T C 1: 166,152,782 L138P probably damaging Het
Hlf T C 11: 90,345,888 D181G probably damaging Het
Irgm1 A G 11: 48,865,871 L387S probably benign Het
Kctd1 T C 18: 14,969,688 E812G possibly damaging Het
Klra2 T C 6: 131,228,251 E209G probably benign Het
Klra3 C T 6: 130,335,769 V11M probably benign Het
Kmt2c T C 5: 25,298,887 S3808G probably benign Het
Krtap24-1 A C 16: 88,612,000 S79R probably benign Het
Limch1 T A 5: 67,033,132 H759Q probably benign Het
Map3k4 A G 17: 12,271,546 Y333H probably benign Het
Mmel1 A G 4: 154,889,634 Y377C probably damaging Het
Ms4a14 A T 19: 11,303,749 Y482N possibly damaging Het
Myo9b A G 8: 71,349,031 S1277G probably benign Het
Nab1 T C 1: 52,490,508 T77A possibly damaging Het
Obsl1 T C 1: 75,506,197 S10G probably benign Het
Odc1 A G 12: 17,548,328 T157A possibly damaging Het
Olfr448 T G 6: 42,897,030 L193R probably damaging Het
Olfr917 T C 9: 38,665,484 D120G probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plpp1 T A 13: 112,806,523 probably benign Het
Prdm13 G A 4: 21,679,125 A455V possibly damaging Het
Ptpn13 A T 5: 103,591,235 Y2289F probably damaging Het
Ptpn18 G T 1: 34,459,885 R21L probably benign Het
Ptprd A G 4: 75,998,499 probably null Het
Rcn3 G T 7: 45,083,671 D258E probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Sacs T A 14: 61,192,446 H651Q probably benign Het
Sacs T C 14: 61,211,253 S3583P probably damaging Het
Scel A G 14: 103,592,371 N463S possibly damaging Het
Serpinb2 A T 1: 107,515,554 I28F possibly damaging Het
Sin3b A G 8: 72,746,503 K484E probably benign Het
Snrnp48 T A 13: 38,216,421 V168D probably damaging Het
Snx18 T G 13: 113,618,395 M1L probably benign Het
Srcap T A 7: 127,559,032 N2693K unknown Het
Stim1 A G 7: 102,428,807 D172G Het
Stip1 A T 19: 7,025,319 L414H probably damaging Het
Sun1 A G 5: 139,223,635 H40R probably damaging Het
Sva T A 6: 42,042,248 D117E possibly damaging Het
Syne2 A G 12: 75,896,670 D321G probably damaging Het
Trim45 A G 3: 100,928,078 D459G probably damaging Het
Trove2 C T 1: 143,765,432 probably null Het
Ttc6 G A 12: 57,651,004 W43* probably null Het
Ugt2b35 A G 5: 87,004,921 T317A possibly damaging Het
Usp32 C T 11: 85,025,544 R858Q probably damaging Het
Yeats2 T C 16: 20,150,562 probably null Het
Zfp804a A G 2: 82,258,403 N859D probably benign Het
Zscan10 A T 17: 23,605,606 Q12L possibly damaging Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12600908 missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12582446 missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12581729 missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12582361 missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12581945 missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12581466 unclassified probably benign
IGL03064:Vmn2r53 APN 7 12601010 missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12600864 missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12606508 missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12606391 missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12581892 missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12598422 missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12582066 missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12582411 missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12581780 missense probably benign
R0881:Vmn2r53 UTSW 7 12600932 missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12601214 missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12581502 missense probably benign
R1102:Vmn2r53 UTSW 7 12598483 missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12600746 missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12581606 missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12584774 missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12581705 missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12600885 missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12598511 missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12601439 missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12582054 missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12581729 missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12582302 missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12582005 missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12600974 missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12601202 missense probably benign
R4710:Vmn2r53 UTSW 7 12601202 missense probably benign
R4774:Vmn2r53 UTSW 7 12600765 nonsense probably null
R4859:Vmn2r53 UTSW 7 12601403 missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12581814 missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12601420 missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12600806 missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12582401 missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12581881 missense probably benign
R6312:Vmn2r53 UTSW 7 12598639 critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12581706 missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12601433 missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12606514 missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12601142 missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12582416 missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12581586 nonsense probably null
R7174:Vmn2r53 UTSW 7 12581701 missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12601056 missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12606432 missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12581919 missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12598498 missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12606491 missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12582099 missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12601395 missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12581916 missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12606354 missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12581810 missense probably damaging 1.00
R8963:Vmn2r53 UTSW 7 12581999 missense probably damaging 1.00
R9042:Vmn2r53 UTSW 7 12581508 missense probably benign
R9076:Vmn2r53 UTSW 7 12606304 missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12601197 missense probably damaging 0.99
R9690:Vmn2r53 UTSW 7 12581985 missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12601304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCCCCAACCATCTCTGAAG -3'
(R):5'- GTGTTGCAAGGCACATTTGG -3'

Sequencing Primer
(F):5'- TCTCTTACCTGCCAGGAATGGAAG -3'
(R):5'- GCCTTCTGTATCACAGCAGCAG -3'
Posted On 2021-08-02