Incidental Mutation 'R8924:Efl1'
ID 679468
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GPTase 1
Synonyms 6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock # R8924 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 82648614-82777852 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 82762953 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 850 (G850D)
Ref Sequence ENSEMBL: ENSMUSP00000046046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
AlphaFold Q8C0D5
Predicted Effect probably benign
Transcript: ENSMUST00000039881
AA Change: G850D

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: G850D

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179489
AA Change: G850D

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: G850D

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (88/90)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,295,461 N572D probably benign Het
Abca8b A G 11: 109,947,177 V1145A probably benign Het
Ank1 T C 8: 23,098,995 M562T probably benign Het
Atn1 A T 6: 124,745,248 S881T probably benign Het
B3galt1 C T 2: 68,118,715 T258I probably benign Het
Bahcc1 C T 11: 120,276,765 L1331F probably benign Het
Capn12 G A 7: 28,883,203 V168M probably damaging Het
Card14 T C 11: 119,326,104 V338A possibly damaging Het
Cd27 T C 6: 125,236,469 probably benign Het
Cd37 A G 7: 45,238,685 L37P probably damaging Het
Cd96 A G 16: 46,099,022 L212P probably damaging Het
Celsr1 T C 15: 86,032,470 E434G possibly damaging Het
Cep152 A G 2: 125,602,858 M456T possibly damaging Het
Ces3b G A 8: 105,084,987 R45H probably benign Het
Cfap54 T G 10: 93,001,823 T1072P probably damaging Het
Chodl A T 16: 78,941,771 M172L possibly damaging Het
Cilp2 A G 8: 69,886,458 S47P probably damaging Het
Clasrp T C 7: 19,584,307 I596V unknown Het
Clcn2 C T 16: 20,712,180 V267I probably damaging Het
Cntln T A 4: 84,888,699 D139E probably damaging Het
Cyp2j12 A C 4: 96,106,448 N379K probably damaging Het
Defb21 T C 2: 152,574,784 V60A possibly damaging Het
Dnajc16 G T 4: 141,766,707 S543* probably null Het
Efcab12 G T 6: 115,823,703 H120N probably benign Het
Efna1 T C 3: 89,276,328 M64V probably benign Het
Eif2ak3 T C 6: 70,893,019 W897R probably damaging Het
Eif2ak4 T A 2: 118,428,032 F621Y probably damaging Het
Erbin C A 13: 103,839,458 E643* probably null Het
Esr1 G A 10: 4,857,176 W364* probably null Het
Fam171a2 T C 11: 102,440,035 E206G possibly damaging Het
Fam90a1a T C 8: 21,961,413 F97L probably benign Het
Fap A T 2: 62,547,821 F181I probably benign Het
Fem1b T C 9: 62,797,634 N115D probably damaging Het
Gal3st2b G T 1: 93,940,931 A295S probably benign Het
Galnt10 G A 11: 57,783,855 probably benign Het
Gcfc2 T C 6: 81,932,898 V224A probably damaging Het
Gh T C 11: 106,300,808 E136G probably damaging Het
Gjd3 C T 11: 98,982,499 C173Y probably damaging Het
Gm11639 AACTCTA AA 11: 104,915,427 probably null Het
Gm12695 T A 4: 96,762,809 M136L probably benign Het
Gm156 G T 6: 129,768,121 H171N probably benign Het
Gnas A G 2: 174,299,484 E482G unknown Het
Gpa33 T C 1: 166,152,782 L138P probably damaging Het
Hlf T C 11: 90,345,888 D181G probably damaging Het
Irgm1 A G 11: 48,865,871 L387S probably benign Het
Kctd1 T C 18: 14,969,688 E812G possibly damaging Het
Klra2 T C 6: 131,228,251 E209G probably benign Het
Klra3 C T 6: 130,335,769 V11M probably benign Het
Kmt2c T C 5: 25,298,887 S3808G probably benign Het
Krtap24-1 A C 16: 88,612,000 S79R probably benign Het
Limch1 T A 5: 67,033,132 H759Q probably benign Het
Map3k4 A G 17: 12,271,546 Y333H probably benign Het
Mmel1 A G 4: 154,889,634 Y377C probably damaging Het
Ms4a14 A T 19: 11,303,749 Y482N possibly damaging Het
Myo9b A G 8: 71,349,031 S1277G probably benign Het
Nab1 T C 1: 52,490,508 T77A possibly damaging Het
Obsl1 T C 1: 75,506,197 S10G probably benign Het
Odc1 A G 12: 17,548,328 T157A possibly damaging Het
Olfr448 T G 6: 42,897,030 L193R probably damaging Het
Olfr917 T C 9: 38,665,484 D120G probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plpp1 T A 13: 112,806,523 probably benign Het
Prdm13 G A 4: 21,679,125 A455V possibly damaging Het
Ptpn13 A T 5: 103,591,235 Y2289F probably damaging Het
Ptpn18 G T 1: 34,459,885 R21L probably benign Het
Ptprd A G 4: 75,998,499 probably null Het
Rcn3 G T 7: 45,083,671 D258E probably damaging Het
Rsf1 GCG GCGACGGCGCCG 7: 97,579,907 probably benign Het
Sacs T A 14: 61,192,446 H651Q probably benign Het
Sacs T C 14: 61,211,253 S3583P probably damaging Het
Scel A G 14: 103,592,371 N463S possibly damaging Het
Serpinb2 A T 1: 107,515,554 I28F possibly damaging Het
Sin3b A G 8: 72,746,503 K484E probably benign Het
Snrnp48 T A 13: 38,216,421 V168D probably damaging Het
Snx18 T G 13: 113,618,395 M1L probably benign Het
Srcap T A 7: 127,559,032 N2693K unknown Het
Stim1 A G 7: 102,428,807 D172G Het
Stip1 A T 19: 7,025,319 L414H probably damaging Het
Sun1 A G 5: 139,223,635 H40R probably damaging Het
Sva T A 6: 42,042,248 D117E possibly damaging Het
Syne2 A G 12: 75,896,670 D321G probably damaging Het
Trim45 A G 3: 100,928,078 D459G probably damaging Het
Trove2 C T 1: 143,765,432 probably null Het
Ttc6 G A 12: 57,651,004 W43* probably null Het
Ugt2b35 A G 5: 87,004,921 T317A possibly damaging Het
Usp32 C T 11: 85,025,544 R858Q probably damaging Het
Vmn2r53 G T 7: 12,600,825 Q303K probably benign Het
Yeats2 T C 16: 20,150,562 probably null Het
Zfp804a A G 2: 82,258,403 N859D probably benign Het
Zscan10 A T 17: 23,605,606 Q12L possibly damaging Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82658111 missense probably damaging 1.00
IGL00696:Efl1 APN 7 82651872 splice site probably benign
IGL01344:Efl1 APN 7 82681480 splice site probably benign
IGL01871:Efl1 APN 7 82763319 missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82697976 missense probably benign 0.17
IGL02104:Efl1 APN 7 82658055 critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82686691 missense probably benign
IGL02484:Efl1 APN 7 82683039 missense probably damaging 0.98
IGL03140:Efl1 APN 7 82692881 missense probably benign 0.00
IGL03188:Efl1 APN 7 82671701 missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82651886 missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82658165 missense probably benign 0.14
R0148:Efl1 UTSW 7 82671670 missense probably damaging 1.00
R0226:Efl1 UTSW 7 82693011 splice site probably benign
R0638:Efl1 UTSW 7 82651887 missense probably damaging 1.00
R0684:Efl1 UTSW 7 82651886 missense probably damaging 1.00
R1018:Efl1 UTSW 7 82763013 missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82671728 missense probably damaging 1.00
R1720:Efl1 UTSW 7 82683721 missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82763117 nonsense probably null
R1973:Efl1 UTSW 7 82762877 missense probably damaging 1.00
R2016:Efl1 UTSW 7 82753709 missense probably damaging 1.00
R2124:Efl1 UTSW 7 82692913 missense probably damaging 1.00
R2290:Efl1 UTSW 7 82777670 missense probably damaging 1.00
R2415:Efl1 UTSW 7 82697967 missense probably damaging 1.00
R3545:Efl1 UTSW 7 82762810 missense probably benign 0.00
R3688:Efl1 UTSW 7 82762970 missense probably benign 0.00
R4092:Efl1 UTSW 7 82762827 missense probably benign 0.00
R4207:Efl1 UTSW 7 82750816 missense probably damaging 0.98
R4347:Efl1 UTSW 7 82697966 missense probably damaging 1.00
R4425:Efl1 UTSW 7 82763283 missense probably damaging 0.99
R4816:Efl1 UTSW 7 82671719 missense probably damaging 1.00
R4858:Efl1 UTSW 7 82671627 missense probably damaging 1.00
R5077:Efl1 UTSW 7 82658087 missense probably damaging 1.00
R5185:Efl1 UTSW 7 82772499 missense probably damaging 1.00
R5319:Efl1 UTSW 7 82674506 missense probably damaging 1.00
R5771:Efl1 UTSW 7 82692524 missense probably benign 0.26
R5857:Efl1 UTSW 7 82763189 missense probably benign
R5956:Efl1 UTSW 7 82651899 missense probably damaging 1.00
R6433:Efl1 UTSW 7 82674568 missense probably damaging 1.00
R7131:Efl1 UTSW 7 82658064 missense probably damaging 1.00
R7143:Efl1 UTSW 7 82762680 missense probably damaging 1.00
R7312:Efl1 UTSW 7 82681444 missense probably benign 0.10
R7409:Efl1 UTSW 7 82697913 missense probably damaging 0.98
R7422:Efl1 UTSW 7 82681379 missense probably damaging 1.00
R7453:Efl1 UTSW 7 82681467 missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82683049 missense probably damaging 1.00
R7884:Efl1 UTSW 7 82658099 missense probably damaging 1.00
R7969:Efl1 UTSW 7 82692970 missense probably benign 0.03
R8394:Efl1 UTSW 7 82762778 missense probably benign 0.00
R8702:Efl1 UTSW 7 82750790 critical splice acceptor site probably null
R9463:Efl1 UTSW 7 82777525 missense probably damaging 1.00
R9762:Efl1 UTSW 7 82763388 missense probably benign 0.09
Z1088:Efl1 UTSW 7 82692850 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCTCCTTGAACGAGGGTAG -3'
(R):5'- TGACCTTGGTGCTGTTTATCAC -3'

Sequencing Primer
(F):5'- TCCTCCTTGAACGAGGGTAGAAATAC -3'
(R):5'- GGTGCTGTTTATCACTTGCTC -3'
Posted On 2021-08-02